Dataset for CDS BAX of Organism Oreochromis niloticus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|I3IYF0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Oreochromis niloticus GN=BAX (length=399 residues).
atggcatcacacccaggaggaggcgatcaagggaattccggagatcagatactggaagtcggaactattttgttacagga
tttcatctatgagcgagttcagaggcaaaaagatggcaataaagcagtgacgagagaacagcttggtggaagccagttga
ctgacccaaaaactaagaagcttgctcagtgcctgcagcagattggagacgagctggatggaaatgtagacctccaaaga
atgataaatgactcttcactttgtcccacaagagaggtttttatgagagtggcctatgagatcttttcagatggaatatt
taactggggcagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
>gnl|bcl2dbcds|I3KNV2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Oreochromis niloticus GN=BAX (length=612 residues).
atggctgacggccgagagggggagaatccggagcaggagcctaggggcgccgcgggtggagacgatgtcattgatgatcc
catcctcgaagaaggagcggttgtctttagagggtatgtgattgcacatataaacacagaggaccctagtcgacatgtga
cttctgaggatttgggaggaaggccagatgaacaacaggatccacaaatcaaagaagtggtagaacagctgcgcaagata
gcggacagtttaaatcggaatgctgaacttcagaggctgataaaccaggttcaggggaactgtgctcaagacgtcttcat
gactgttgcaagaaacatctttgctgatggtatcaactggggtcgaatagtggctctcttccatctggcctgtaaactta
tacacaaggctattaccgccaatcacttggagaacatccaaatgatcatcagctgggtcctccaggttatcagagagcag
gtctacagctggcttgtggcgcaagggggctgggagggggtgatccgtggtttttctcgatggaggacagcagccatggt
agcatcagtagtattggtggtagccttcgtttactaccggaaagtacgataa
© 1998-2018