Dataset for CDS Unclassified of Organism Oncorhynchus mykiss

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|C1BGE1_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Oncorhynchus mykiss (length=603 residues).
atggcgtgtgcagagatatcagattacagagtaggagaggtcctgctgaatagagtgatgcaggagcagctggatgaggt
gccatcagacgtcccggtagtggtctccacaaaaacccaggaggtggagagtgatcaggagcagaagattgtgtcacagc
tagctatcatgatacggaccatcggagacgccatcaagaaggacgggaagctggacgatgcgatagatggaatggtaggg
aaaatgaccagccagaccagctactggaacttggtagaaaaggtatttgaggacagtcaaatcacctgggagagaattgc
tgtgctgttttacgtagcagggaggatagccgtcaaggtggtgattgctaacatcccccagttagtgaaggacattctga
agtggactctggagtatttcagaagcaaattactggattggatccagaaacatggaggatggatgaacagttttgctgag
ctggcacgtgtgcaggtggagaagatgtcccctatgagcacctggtcctcagcgtccatcctggtcttcctcggtgtcat
actgggtagtgttatcacctggaaactggccaggaggacctga
© 1998-2018