Dataset for CDS Unclassified of Organism Octopus bimaculoides

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A0L8HQA5_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Octopus bimaculoides (length=657 residues).
atgactactgattatgaacgtagtagagtaggctctccattcgcagtcatcaatcgacgttttcaacaacttcccggttt
tcaaggacttaacaatattggtcaaaccggcgatgccgaatcagcccgtttagaaggtaatacaacgcaattagaaagag
tttgcagggatgctgaaaatattgccgatgatgtcatacagtttttcattaatccaggaaagaagccacttaaccgtcat
tgcaaaacgatgcgaagaacggtacaagaactttcaaaacgacacgacattttatttaaaactatgataaatagactcca
agtggacgacatgaatcttttcatttcctttacatatgtaacagatgaaatattcgaagacggacaaattaattggggtc
gtgttgtagctgtttatgcgttcgccgctagactggctttacattttcatgacattcaaaaaccggaaaagtgtaatcaa
attgcattatatacaggccgatacgttggtaaaaaactaggaaagtggattattgagtctggcggatgggataatttctc
tgactttttccctgaacaagtccaagaagacagattgtggagaggattcgtatttgcagcatttggtcttggtgcattgg
tcattgctacccagtga
>gnl|bcl2dbcds|A0A0L8HTD6_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Octopus bimaculoides (length=546 residues).
atggcttacttaataattgctcagcaggctaaagctgtatttctaggttttgtccaggagaaaacaaagttagaaaataa
ggaacttcattctgaagccgagaatattatttgtgaggatgaagttgatgcaaagtatgtattagttgggaagcagctgg
ctgaaattggagataaagtgaatgaagaaaataaagaagcatttgaggtcatggctaatctattagatataaaaagtgat
tcattagttatacaatttatgaacattgttgacctaattgattgctcaaatcaaggcagaatactggtattgttctgctt
tgcgtactatctgctacgtcgatttacgaaagaaatatttcaaaaaattctgctgtgtatttcgaattttgtgggaatta
gtcttgcacgatggatatataatcaaggtggatgggcgatgactactgaccgagacctttggaaatgtgctgtatggagt
accagttatggagtcagtttgatcaaggctggtctaaagctaaatgacaacttaagatctacatga
© 1998-2018