Dataset for CDS BAX-like of Organism Octopus bimaculoides

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A0L8HMI8_BAX-01 BCL2-associated X gene OS=[Eukaryota] Octopus bimaculoides GN=BAX (length=621 residues).
atgtattccttgaatgtccattgcaccatgatcaaatctacacaagaaccgcccaggaaaaacttaaacagagatgacgt
gggcaaccaggcgcggtgtttgctgaaccagttcatccatgacagaatggaaaatgaaggctttgaaaatcctctgcaag
agtccaacctcatcgaaccagacacaccaacaggtccaccgatgtctcagctagaagaaataggacgtgctctacggtgt
attggtgacgaattagatggagaccaaagactgcaagatttggtatcaagaatagagcctgaagatattcccaatacatt
tctcaatgttgccagtgctattgtctctgtaaaccttacttgggatatagtggttcggttcttttactttgcctacaaaa
tggccatcaaggcattggaccggattcctttaatccgagccatcatcaacttagttattaattttatagtagacaatctt
gctgattggattctatctcgaggtggatgggaagccattgtggaatattttggcaccccaaagaggcaagcctttggcgt
tttaatagccggtgttcttatcagtgttggcgtctatgcgtggaagagtattggtaattaa
>gnl|bcl2dbcds|A0A0L8HMI8_BAX-02 BCL2-associated X gene OS=[Eukaryota] Octopus bimaculoides GN=BAX (length=606 residues).
atggatctcgaggagagaaaaatacgggctaaaccgcccaggaaaaacttaaacagagatgacgtgggcaaccaggcgcg
gtgtttgctgaaccagttcatccatgacagaatggaaaatgaaggctttgaaaatcctctgcaagagtccaacctcatcg
aaccagacacaccaacaggtccaccgatgtctcagctagaagaaataggacgtgctctacggtgtattggtgacgaatta
gatggagaccaaagactgcaagatttggtatcaagaatagagcctgaagatattcccaatacatttctcaatgttgccag
tgctattgtctctgtaaaccttacttgggatatagtggttcggttcttttactttgcctacaaaatggccatcaaggcat
tggaccggattcctttaatccgagccatcatcaacttagttattaattttatagtagacaatcttgctgattggattcta
tctcgaggtggatgggaagccattgtggaatattttggcaccccaaagaggcaagcctttggcgttttaatagccggtgt
tcttatcagtgttggcgtctatgcgtggaagagtattggtaattaa
© 1998-2018