Dataset for CDS BOK of Organism Nomascus leucogenys

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G1R8A1_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Nomascus leucogenys GN=BOK (length=636 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctgggccgggagtacgtgcacgcgcggctactgcgcgccggcctctcttggagcgcgcccg
agcgcgccgcggtcccgggacgcctggccgaggtgtgcgcggtgctgctgcgcctgggggatgagctggagatgatccgg
cccagcatctaccgcaacgtggcgcgtcagctgcacatctccctgcagtctgagcctgtggtgaccgatgcgttcctggc
cgtggctggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccctgtatgcggtggccgcggggctggccg
tggactgtgtgaggcaggcccagcctgccatggtccacaccctcgtggactgcctgggggagttcgtgcgcaagaccctg
gcgacctggctgcggagacgcggcggatggactgatgtcctcaagtgtgtggtcagcacagaccctggcctccgctccca
ctggctggtggccgcactctgcagcttcggccgcttcctgaaggctgccttcttcgtgctgctgccagagagatga
© 1998-2018