Dataset for CDS BAX-like of Organism Nomascus leucogenys

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A2I3GW67_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Nomascus leucogenys GN=BAK1 (length=549 residues).
gagcaggtagcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaagg
ggcagctgcccctgccgacccagagatggtcaccttacctctgcaacccagcagcaccatggggcaggtgggacggcagc
tcgccatcatcggggacgacatcaaccgacttcaggccatgttgcagcacctgcagcccacggcagagaatgtctatgag
tacttcaccaagattgcctccagcctgtttgagagtggcatcaactggggccgtgtggtggctcttctggctttcggcta
ccgtatggccctacacgtctaccagcatggcctgactggcttcctgggccaggtgacccgcttcgtggttgacttcatgc
tgcatcgctgcattgcccggtggattgcacagaggggtggctgggtggcagccctggacttgggcaatggtcccatcctg
atcgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2I3GW67_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Nomascus leucogenys GN=BAK1 (length=375 residues).
gagcaggtagcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaagg
ggcagctgcccctgccgacccagagatggtcaccttacctctgcaacccagcagcaccatggggcaggtgggacggcagc
tcgccatcatcggggacgacatcaaccgacttcaggccatgttgcagcacctgcagcccacggcagagaatgtctatgag
tacttcaccaagattgcctccaggccagcagcaacacccacagcctgtttgagagtggcatcaactggggccgtgtggtg
gctcttctggctttcggctaccgtatggccctacacgtctaccagcatggcctga
>gnl|bcl2dbcds|G1QXN2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Nomascus leucogenys GN=BAX (length=585 residues).
cagatcatgaagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatggggggggaggcacccga
gctggccctggacccggtgcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactgg
acagtaacatggagctgcagaggatgattgctgccgtggacacagactccccacgagaggtctttttccgagtggcagct
gaaatgttttctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggc
cctgtgcaccaaggtgcccgaactgatcagaaccatcatgggctggacattggacttcctccgggagcggctgttgggct
ggatccaagaccagggtggttgggtgagactcctcaagcctcctcaccctaaccaccacgccctcaccaccgcccctgcc
ccaccgtccctgcccccccaccactcctctgggaccctgggccttctggagcaggtcacagtggtgccctctccccattg
taggatcatcagatgtggtttataa
>gnl|bcl2dbcds|G1R8A1_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Nomascus leucogenys GN=BOK (length=636 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctgggccgggagtacgtgcacgcgcggctactgcgcgccggcctctcttggagcgcgcccg
agcgcgccgcggtcccgggacgcctggccgaggtgtgcgcggtgctgctgcgcctgggggatgagctggagatgatccgg
cccagcatctaccgcaacgtggcgcgtcagctgcacatctccctgcagtctgagcctgtggtgaccgatgcgttcctggc
cgtggctggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccctgtatgcggtggccgcggggctggccg
tggactgtgtgaggcaggcccagcctgccatggtccacaccctcgtggactgcctgggggagttcgtgcgcaagaccctg
gcgacctggctgcggagacgcggcggatggactgatgtcctcaagtgtgtggtcagcacagaccctggcctccgctccca
ctggctggtggccgcactctgcagcttcggccgcttcctgaaggctgccttcttcgtgctgctgccagagagatga
© 1998-2018