Dataset for CDS BAK1 of Organism Nomascus leucogenys

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A2I3GW67_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Nomascus leucogenys GN=BAK1 (length=549 residues).
gagcaggtagcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaagg
ggcagctgcccctgccgacccagagatggtcaccttacctctgcaacccagcagcaccatggggcaggtgggacggcagc
tcgccatcatcggggacgacatcaaccgacttcaggccatgttgcagcacctgcagcccacggcagagaatgtctatgag
tacttcaccaagattgcctccagcctgtttgagagtggcatcaactggggccgtgtggtggctcttctggctttcggcta
ccgtatggccctacacgtctaccagcatggcctgactggcttcctgggccaggtgacccgcttcgtggttgacttcatgc
tgcatcgctgcattgcccggtggattgcacagaggggtggctgggtggcagccctggacttgggcaatggtcccatcctg
atcgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2I3GW67_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Nomascus leucogenys GN=BAK1 (length=375 residues).
gagcaggtagcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaagg
ggcagctgcccctgccgacccagagatggtcaccttacctctgcaacccagcagcaccatggggcaggtgggacggcagc
tcgccatcatcggggacgacatcaaccgacttcaggccatgttgcagcacctgcagcccacggcagagaatgtctatgag
tacttcaccaagattgcctccaggccagcagcaacacccacagcctgtttgagagtggcatcaactggggccgtgtggtg
gctcttctggctttcggctaccgtatggccctacacgtctaccagcatggcctga
© 1998-2018