Dataset for CDS Unclassified of Organism Nematostella vectensis

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A7SZR5_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Nematostella vectensis (length=306 residues).
atgttagaagaatgttatccacgtctatacgcggacatttctcgccatgtaaatgcttcttttaccagcgaaacagtggt
gcatgatgtattttcaagtgtatgtacagaaatagtcaaagatggagttaattgggctaggattatcgcagtgtatacat
ttgctggagcccttgccacagaatgttacaaagacagtagaagcgtgtttgttacggaagttagcaattggatgtatgaa
tttaccgctctacatctcgtagactggattaagaagcgcggcggatgggtaagtatttatgattga
>gnl|bcl2dbcds|A7T5K5_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Nematostella vectensis (length=675 residues).
atggagaatgcatacccagcgctgtatcaaaacattagcgaacagctcaactttagaatcaatctagagattgtcgtttg
cggcatgtttacttgcgtgtgtgataatattcttgcgtccggtataacctgggccagggtcgtatcactatatgctttcg
cggcagcccttgccgttgactgttgccaaacagacgtcagaattgctaagaatatttccaaatggatgggtcagtacacg
aagaaaaggacatatccgattgcctatatgaagaatcttgtcttgcttatcgcgtgctttagcgtggggctagcgaatga
tgatgacttctgcaaagaaaaagacgccggccattacacggacccagctgattgtgccaagttctaccagtgcgatggct
ttcacaggaccttccacaggatgtgctcagacgtacccaaatggagtgtaatgaaaagcacctgtgaccatgctaagaat
gtagactgcagactcaaatctcaccccgaatgttgtggtgcctctcagagaaccacgatcctacaaaagcttgaattctt
ctgctacacatgtgctgcagaaaaccagatgatgctagcgcagggattacagcctgcgcaacaacaggtgtggattggct
accgtcggcttaggcatgaaacaccattctactga
© 1998-2018