Dataset for CDS BAK1 of Organism Nematostella vectensis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A7RF38_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Nematostella vectensis GN=BAK1 (length=567 residues).
atggcgagcgctggtgatttacccccggaagaaggggtccaacaggagccatcagaggactccgaaaagactgttgttag
tgaaaccgaaggtgttttccgttattttatgtaccagcgatttcaagatgaagccgaacggggtgatactgaagttcagt
ttacagaggcgagatccgatgctttggaagaacttcgctcttgtaacgatacatcaaggcaacatattgcgaccattggc
cgacgtctgggggaagttggagatgaaatcgatgctaaatatagagaccaattccatgacatgatagaaagcttgcatct
cacgccgggaacagcctacgatacatttgccgcggttgcccgccgactatttcgttctggtataagttggggaagaatca
tcgctttactgtgctttggatacgagattgcgattactgtaatacgaagaggattcagcgggagcttccttagaaggatt
attcgctttgttgtggactttatatttcgcgagaggatagcaagatggattgcagagcacggtggctgggttgcagtgat
gtcatga
© 1998-2018