Dataset for CDS BAX of Organism Mytilus galloprovincialis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|R4JJI2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Mytilus galloprovincialis GN=BAX (length=630 residues).
atggcagcagcacaaggaacatacaaccccttactttccaaaaaaatgccaagagaatacaagcgacagttaagtaaaga
tgacataggtaaccaagctagagtattgttgaaccacttcatccacgacagaatatctcgtgaacaaggagaggaacaag
tgccatctaccgaggaacttcaagaaccaggtaccccaacaggtccaccattagaacacattcaagaaataggacgagca
ttacgatgtataggagatgaattagacaaaaatgaaaacattcagagtttatgttcacaagtttctccagaagcaactac
agatacattcctaactgtggccaagagttttttctctgatggagtttataactggggacgtgtaggcagtctattttatt
ttgcctataaaatggtagtcaaggccttgaataaaatagcattaataagagcaataataaattgggtggtgaactttata
acagattatgtcgccccctggataatagaacgaggtggttgggaagccattgaagaatattttggaacaccgaaaaatca
gatgatgtttgttttaggacttggggcattaactgttgtaggagtatatatatataaaacttggaactga
© 1998-2018