Dataset for CDS BOK of Organism Myotis lucifugus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G1QFV7_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Myotis lucifugus GN=BOK (length=489 residues).
gcccccaaggccgccgcgctcgccccgggcggccgcctcgcagaggtgtgcacggtgctgctgcgcctgggggatgagct
ggagctgattcggcccagcatctaccgcaacgtggcgcgccagctgaacatctccctgcactctgagagcgtggtgaccg
acgccttcctggctgtggccgcccagatctttgctgcaggcatcacgtggggcaaggtggtgtccctgtacttggtggct
gcggggctggctgtggactgtgtgcggcaggcccagcccgccgtggttcatgctctcgtcgactgcctcggggagtttgt
gcgcaagaccctggcaacctggctgcggaggcgcggtggatggaccgacgtcctcaagtgtgtggtcagcagcaaccctg
gcttccagtcccattggtttgtgactgcactctgcagcttcggccgcttcctgaaggctgccttctttgtgctgttgcca
gaaagatga
© 1998-2019