Dataset for CDS BAX-like of Organism Myotis lucifugus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|G1PFJ7_BAX-01 BCL2-associated X gene OS=[Eukaryota] Myotis lucifugus GN=BAX (length=582 residues).
atggacgggtccggggagcagcccagagacggggggcccaccagctctgagcagatcatgaagacaggggcccttttact
aaagcttcatccaaggaccaagcagagcacatggggggagaggcgtccccagctgcccctggggcccagggtcccccagg
atgcatccaccaagaagctcagcgagtgcctcaagcgcattggcgacgagctcgacagtaacatggagctgcagaggatg
atcgcggctgtggacacagactccccccgagaggtcttcttccgagtggcgtccgaaatgttctccgacggcaacttcaa
ctggggccgggttgtcgccctcttctactttgccagcaaactggtgctcaaggccctgtgcaccaaagtgcctgagctgt
tcaggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccagggcggttgggac
ggcctcctctcctactttgggacctccacgtggcataccgtgactatcttcgtggccggggtgcttatcgcctccatcac
ctactgtgagataatgggctga
>gnl|bcl2dbcds|G1QFV7_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Myotis lucifugus GN=BOK (length=489 residues).
gcccccaaggccgccgcgctcgccccgggcggccgcctcgcagaggtgtgcacggtgctgctgcgcctgggggatgagct
ggagctgattcggcccagcatctaccgcaacgtggcgcgccagctgaacatctccctgcactctgagagcgtggtgaccg
acgccttcctggctgtggccgcccagatctttgctgcaggcatcacgtggggcaaggtggtgtccctgtacttggtggct
gcggggctggctgtggactgtgtgcggcaggcccagcccgccgtggttcatgctctcgtcgactgcctcggggagtttgt
gcgcaagaccctggcaacctggctgcggaggcgcggtggatggaccgacgtcctcaagtgtgtggtcagcagcaaccctg
gcttccagtcccattggtttgtgactgcactctgcagcttcggccgcttcctgaaggctgccttctttgtgctgttgcca
gaaagatga
© 1998-2018