Dataset for CDS BAX of Organism Myotis lucifugus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G1PFJ7_BAX-01 BCL2-associated X gene OS=[Eukaryota] Myotis lucifugus GN=BAX (length=582 residues).
atggacgggtccggggagcagcccagagacggggggcccaccagctctgagcagatcatgaagacaggggcccttttact
aaagcttcatccaaggaccaagcagagcacatggggggagaggcgtccccagctgcccctggggcccagggtcccccagg
atgcatccaccaagaagctcagcgagtgcctcaagcgcattggcgacgagctcgacagtaacatggagctgcagaggatg
atcgcggctgtggacacagactccccccgagaggtcttcttccgagtggcgtccgaaatgttctccgacggcaacttcaa
ctggggccgggttgtcgccctcttctactttgccagcaaactggtgctcaaggccctgtgcaccaaagtgcctgagctgt
tcaggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccagggcggttgggac
ggcctcctctcctactttgggacctccacgtggcataccgtgactatcttcgtggccggggtgcttatcgcctccatcac
ctactgtgagataatgggctga
© 1998-2018