Dataset for CDS BAX of Organism Mustela putorius furo

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|M3XW26_BAX-01 BCL2-associated X gene OS=[Eukaryota] Mustela putorius furo GN=BAX (length=579 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaagatcgagcagggcgaatggggggagagacacccgagctggcccttgagcaggcgccacaggatg
catccaccaagaagctgagcgagtgtctcaagcgcatcggagatgaactggacagtaacatggagttacagaggatgatc
gcagctgtggacacagactccccccgcgaggtctttttccgagtggcagctgaaatgttttctgatggcaacttcaactg
gggtcgggtcgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatca
ggaccatcatgggctggacactggacttccttcgagagcgactgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggctggagtgctcactgcatcactcaccat
ctggaaaaagatgggctga
© 1998-2018