Dataset for CDS BAK1 of Organism Mustela putorius furo

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|M3XTL2_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Mustela putorius furo GN=BAK1 (length=636 residues).
atggcatccgggcaaggcccaggtcctcccaggcagggatgtggagagccggccccatcttctacttctgaggagcaggt
agcccgggacactgaggaggttttccgcagctatgttttttaccgccatcggcaggagcaggaggctgagggggcggctg
cgcctgctgacccagaaatggtctccttgtccctagaacctagcagcaccatggggcaggtgggtcggcagcttgccatc
atcggggacgacatcaaccagcgctacgactccgagttccaggccatgctgcagcacctgcagccaacagcggagaatgc
ctatgagtatttcatcaagattgcctcgagcctgttcgagagtggcattaactggggccgcgtggtggctctcctgagct
tcggctaccgcctggccctccacgtctaccagcgcggcctgaccggcttcctgggccaggtgacccgcttcgtggctgac
ttcatgctgcatcactgcattgctcggtggattgcgcagaggggcggctgggtggcagccctgaacttgggaaatggccc
catcctgaacgtgctgatagttctgtctgtggttctattgggccagtttgtggtacgaagattcttcaaatcgtga
© 1998-2018