Dataset for CDS BAX-like of Organism Mus musculus

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|O08734_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Mus musculus GN=BAK1 (length=456 residues).
atggcatctggacaaggaccaggtcccccgaaggtgggctgcgatgagtccccgtccccttctgaacagcaggttgccca
ggacacagaggaggtctttcgaagctacgttttttacctccaccagcaggaacaggagacccagggggcggccgcccctg
ccaaccccgagatggacaacttgcccctggaacccaacagcatcttgggtcaggtgggtcggcagcttgctctcatcgga
gatgatattaaccggcgctacgacacagagttccagaatttactagaacagcttcagcccacagccgggaatgcctacga
actcttcaccaagatcgcctccaggccagcagcaacatgcacagcctatttaagagtggcatcagctggggccgcgtggt
ggctctcctgggctttggctaccgtctggccctgtacgtctaccagcgtggtttga
>gnl|bcl2dbcds|O08734_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Mus musculus GN=BAK1 (length=630 residues).
atggcatctggacaaggaccaggtcccccgaaggtgggctgcgatgagtccccgtccccttctgaacagcaggttgccca
ggacacagaggaggtctttcgaagctacgttttttacctccaccagcaggaacaggagacccagggggcggccgcccctg
ccaaccccgagatggacaacttgcccctggaacccaacagcatcttgggtcaggtgggtcggcagcttgctctcatcgga
gatgatattaaccggcgctacgacacagagttccagaatttactagaacagcttcagcccacagccgggaatgcctacga
actcttcaccaagatcgcctccagcctatttaagagtggcatcagctggggccgcgtggtggctctcctgggctttggct
accgtctggccctgtacgtctaccagcgtggtttgaccggcttcctgggccaggtgacctgctttttggctgatatcata
ctgcatcattacatcgccagatggatcgcacagagaggcggttgggtggcagccctgaattttcgtagagaccccatcct
gaccgtaatggtgatttttggtgtggttctgttgggccaattcgtggtacacagattcttcagatcatga
>gnl|bcl2dbcds|O35425_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Mus musculus GN=BOK (length=642 residues).
atggaggtgctgcggcgctcttctgtctttgcagcggagatcatggacgcctttgatcgctcgcccacagacaaggagct
ggtggcccaggctaaggcactaggccgggagtacgtgcacgcgcggcttttgcgcgccggcctctcctggagcgctccag
agcgtgcctcgcctgcccctggaggacgcttggcagaggtgtgcacagtgctgctgcgcttgggagatgagctggagcag
atccgtcccagcgtataccggaacgtggcccggcagctgcacatccccctgcagtcggagcctgtggtgacggatgcctt
cctggcagtggcaggccacatcttctcagcaggtatcacatggggcaaggtagtgtccctgtattccgtggccgcggggc
tagcggtggactgtgtccggcaggctcagcctgccatggttcatgccctggttgactgcctgggggagtttgtacgcaag
accttggctacctggcttcggaggcgtggtggatggacggatgtcctcaagtgtgtggtcagcacagatcctggcttccg
ctcccactggctcgtggccacgctctgcagctttggccgcttcctgaaggcagcattcttcctgttgttgccagagagat
ga
>gnl|bcl2dbcds|O35425_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Mus musculus GN=BOK (length=642 residues).
atggaggtgctgcggcgctcttctgtctttgcagcggagatcatggacgcctttgatcgctcgcccacagacaaggagct
ggtggcccaggctaaggcactaggccgggagtacgtgcacgcgcggcttttgcgcgccggcctctcctggagcgctccag
agcgtgcctcgcctgcccctggaggacgcttggcagaggtgtgcacagtgctgctgcgcttgggagatgagctggagcag
atccgtcccagcgtataccggaacgtggcccggcagctgcacatccccctgcagtcggagcctgtggtgacggatgcctt
cctggcagtggcaggccacatcttctcagcaggtatcacatggggcaaggtagtgtccctgtattccgtggccgcggggc
tagcggtggactgtgtccggcaggctcagcctgccatggttcatgccctggttgactgcctgggggagtttgtacgcaag
accttggctacctggcttcggaggcgtggtggatggacggatgtcctcaagtgtgtggtcagcacagatcctggcttccg
ctcccactggctcgtggccacgctctgcagctttggccgcttcctgaaggcagcattcttcctgttgttgccagagagat
ga
>gnl|bcl2dbcds|Q07813_BAX-01 BCL2-associated X gene OS=[Eukaryota] Mus musculus GN=BAX (length=516 residues).
atggacgggtccggggagcagcttgggagcggcgggcccaccagctctgaacagatcatgaagacaggggcctttttgct
acagggtttcatccaggatcgagcagggaggatggctggggagacacctgagctgaccttggagcagccgccccaggatg
cgtccaccaagaagctgagcgagtgtctccggcgaattggagatgaactggacagcaatatggagctgcagaggatgatt
gctgacgtggacacggactccccccgagaggtcttcttccgggtggcagctgacatgtttgctgatggcaacttcaactg
gggccgcgtggttgccctcttctactttgctagcaaactggtgctcaaggccctgtgcactaaagtgcccgagctgatca
gaaccatcatgggctggacactggacttcctccgtgagcggctgcttgtctggatccaagaccagggtggctgggcctcc
tctcctacttcgggacccccacatggcagacagtga
>gnl|bcl2dbcds|Q07813_BAX-02 BCL2-associated X gene OS=[Eukaryota] Mus musculus GN=BAX (length=579 residues).
atggacgggtccggggagcagcttgggagcggcgggcccaccagctctgaacagatcatgaagacaggggcctttttgct
acagggtttcatccaggatcgagcagggaggatggctggggagacacctgagctgaccttggagcagccgccccaggatg
cgtccaccaagaagctgagcgagtgtctccggcgaattggagatgaactggacagcaatatggagctgcagaggatgatt
gctgacgtggacacggactccccccgagaggtcttcttccgggtggcagctgacatgtttgctgatggcaacttcaactg
gggccgcgtggttgccctcttctactttgctagcaaactggtgctcaaggccctgtgcactaaagtgcccgagctgatca
gaaccatcatgggctggacactggacttcctccgtgagcggctgcttgtctggatccaagaccagggtggctgggaaggc
ctcctctcctacttcgggacccccacatggcagacagtgaccatctttgtggctggagtcctcaccgcctcgctcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|Q8K3J2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Mus musculus GN=BAX (length=522 residues).
atgaagacaggggcctttttgctacagggtttcatccaggatcgagcagggaggatggctggggagacacctgagctgac
cttggagcagccgccccaggatgcgtccaccaagaagctgagcgagtgtctccggcgaattggagatgaactggacagca
atatggagctgcagaggatgattgctgacgtggacacggactccccccgagaggtcttcttccgggtggcagctgacatg
tttgctgatggcaacttcaactggggccgcgtggttgccctcttctactttgctagcaaactggtgctcaaggccctgtg
cactaaagtgcccgagctgatcagaaccatcatgggctggacactggacttcctccgtgagcggctgcttgtctggatcc
aagaccagggtggctgggaaggcctcctctcctacttcgggacccccacatggcagacagtgaccatctttgtggctgga
gtcctcaccgcctcgctcaccatctggaagaagatgggctga
© 1998-2018