Dataset for CDS BAX of Organism Mus musculus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|Q07813_BAX-01 BCL2-associated X gene OS=[Eukaryota] Mus musculus GN=BAX (length=516 residues).
atggacgggtccggggagcagcttgggagcggcgggcccaccagctctgaacagatcatgaagacaggggcctttttgct
acagggtttcatccaggatcgagcagggaggatggctggggagacacctgagctgaccttggagcagccgccccaggatg
cgtccaccaagaagctgagcgagtgtctccggcgaattggagatgaactggacagcaatatggagctgcagaggatgatt
gctgacgtggacacggactccccccgagaggtcttcttccgggtggcagctgacatgtttgctgatggcaacttcaactg
gggccgcgtggttgccctcttctactttgctagcaaactggtgctcaaggccctgtgcactaaagtgcccgagctgatca
gaaccatcatgggctggacactggacttcctccgtgagcggctgcttgtctggatccaagaccagggtggctgggcctcc
tctcctacttcgggacccccacatggcagacagtga
>gnl|bcl2dbcds|Q07813_BAX-02 BCL2-associated X gene OS=[Eukaryota] Mus musculus GN=BAX (length=579 residues).
atggacgggtccggggagcagcttgggagcggcgggcccaccagctctgaacagatcatgaagacaggggcctttttgct
acagggtttcatccaggatcgagcagggaggatggctggggagacacctgagctgaccttggagcagccgccccaggatg
cgtccaccaagaagctgagcgagtgtctccggcgaattggagatgaactggacagcaatatggagctgcagaggatgatt
gctgacgtggacacggactccccccgagaggtcttcttccgggtggcagctgacatgtttgctgatggcaacttcaactg
gggccgcgtggttgccctcttctactttgctagcaaactggtgctcaaggccctgtgcactaaagtgcccgagctgatca
gaaccatcatgggctggacactggacttcctccgtgagcggctgcttgtctggatccaagaccagggtggctgggaaggc
ctcctctcctacttcgggacccccacatggcagacagtgaccatctttgtggctggagtcctcaccgcctcgctcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|Q8K3J2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Mus musculus GN=BAX (length=522 residues).
atgaagacaggggcctttttgctacagggtttcatccaggatcgagcagggaggatggctggggagacacctgagctgac
cttggagcagccgccccaggatgcgtccaccaagaagctgagcgagtgtctccggcgaattggagatgaactggacagca
atatggagctgcagaggatgattgctgacgtggacacggactccccccgagaggtcttcttccgggtggcagctgacatg
tttgctgatggcaacttcaactggggccgcgtggttgccctcttctactttgctagcaaactggtgctcaaggccctgtg
cactaaagtgcccgagctgatcagaaccatcatgggctggacactggacttcctccgtgagcggctgcttgtctggatcc
aagaccagggtggctgggaaggcctcctctcctacttcgggacccccacatggcagacagtgaccatctttgtggctgga
gtcctcaccgcctcgctcaccatctggaagaagatgggctga
© 1998-2018