Dataset for CDS BAK1 of Organism Mus musculus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|O08734_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Mus musculus GN=BAK1 (length=456 residues).
atggcatctggacaaggaccaggtcccccgaaggtgggctgcgatgagtccccgtccccttctgaacagcaggttgccca
ggacacagaggaggtctttcgaagctacgttttttacctccaccagcaggaacaggagacccagggggcggccgcccctg
ccaaccccgagatggacaacttgcccctggaacccaacagcatcttgggtcaggtgggtcggcagcttgctctcatcgga
gatgatattaaccggcgctacgacacagagttccagaatttactagaacagcttcagcccacagccgggaatgcctacga
actcttcaccaagatcgcctccaggccagcagcaacatgcacagcctatttaagagtggcatcagctggggccgcgtggt
ggctctcctgggctttggctaccgtctggccctgtacgtctaccagcgtggtttga
>gnl|bcl2dbcds|O08734_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Mus musculus GN=BAK1 (length=630 residues).
atggcatctggacaaggaccaggtcccccgaaggtgggctgcgatgagtccccgtccccttctgaacagcaggttgccca
ggacacagaggaggtctttcgaagctacgttttttacctccaccagcaggaacaggagacccagggggcggccgcccctg
ccaaccccgagatggacaacttgcccctggaacccaacagcatcttgggtcaggtgggtcggcagcttgctctcatcgga
gatgatattaaccggcgctacgacacagagttccagaatttactagaacagcttcagcccacagccgggaatgcctacga
actcttcaccaagatcgcctccagcctatttaagagtggcatcagctggggccgcgtggtggctctcctgggctttggct
accgtctggccctgtacgtctaccagcgtggtttgaccggcttcctgggccaggtgacctgctttttggctgatatcata
ctgcatcattacatcgccagatggatcgcacagagaggcggttgggtggcagccctgaattttcgtagagaccccatcct
gaccgtaatggtgatttttggtgtggttctgttgggccaattcgtggtacacagattcttcagatcatga
© 1998-2018