Dataset for CDS BAX-like of Organism Monodelphis domestica

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|F6R4F6_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Monodelphis domestica GN=BAK1 (length=615 residues).
atggcttctaggcaggtgaaccgggttcgagccccatcatctactgcagaggaacaggtggcccgagagactgaagaggt
tttccgaagctatgtctactaccgccaccaacaagagcaggaaactgagggagaagctgtccctgcagacccagagatgg
ataccctaccccaagagctcagcagcaccaccgagcaggtgggccgacagcttgccgtcatcggggatgacatcagtcgt
aggtatgactcagaattcaaggccatgctgcagcatttgcagcccacccccgacactgcctatgagtacttcaccaagat
cgcctccagcctgtttgagagcggcatcaactggggccgagtggtggccctgctgggctttggctaccggttggcactac
atgtttatcagcggggcctgaccggcttcctgggccgagtggctcactttgtggctgatttcatgctccatcactgcatt
gcccgctggattgcccagaatgggggctgggtggcagccctgaacctcaccaacaactctatcttgtacgtggtgacagt
cttgggtgtggtcctctttgttcgcttcttgatccgaagattcttccaaccttga
>gnl|bcl2dbcds|F6XQQ4_BAX-01 BCL2-associated X gene OS=[Eukaryota] Monodelphis domestica GN=BAX (length=603 residues).
atggacggctccggagagcagccgcgaggcgggggtgatctgggggccacaagctcggagcagatcatgaggaccggagc
cgtgctgctgcaggggtttatccaggaccgggcgggccgagtggcggggggtgcccccgagctgctcctggactccatgg
gggactcggccccgctgccttcagaccccaggaccaagcggcttaccgagtgcctgcggaggatcggggacgagctggac
agcaacatggagcttcagaggatgatcgccgcggtggagaccgactccccccgggaggtgttcttccgagtggcagccga
gatgttttccgatgggaacttcaactgggggcgggtggtggccctcttctattttgccagcaagctggtgctcaaggcgc
tttgcaccaaggtcccggagctgatccgaaccatagtgggctggaccctagatttcttgagagaacggctgctcacctgg
atccaggaacagggtggctgggacggcctcctctcttacttcgggacaccaacttggcagacagtgaccatcttcgtggc
tggcatcctcaccgcttcccttaccatctggaagatgtcctag
>gnl|bcl2dbcds|F7G9S0_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Monodelphis domestica GN=BOK (length=642 residues).
atggaggttctgcggcgctcctcggtgttcgcggcggaggtgatggaagtgtttgaccgctctcccaccgacaaagagct
cgtgtcccaggccaaagccctgggccgggaatacatccactcccggctcatccgggccggcctggtctggagcaaacccg
aggccaagaccccgacgcctggcgggaagctggcggaggtggccagcatccttctgcggctgggggatgagctggagtac
atcaggcccaacgtctaccggaacattgctcgccagctgaacatctccctacagtctgagagtgtggtgaccgacgcctt
cctggccgtggccacgcagatcttcgcagcaggaataacatggggcaaagtggtctccctctatgccgtggcagcagggc
tggcagtggactgtgtgaagcaggcccagccagccatggtccacaccatcgtggactgcctgggagagtttgtacgcaag
acgctggtgacttggctcaagaggcgaggaggatgggcagacatcatgaagtgtgtggtggacagtgaccccagccttcg
atcgcactggctcgtggccgccctctgcagcttcggccacttcctgaaggccatcttctttgtcctgctgccagagagat
ga
© 1998-2018