Dataset for CDS BAX of Organism Monodelphis domestica

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F6XQQ4_BAX-01 BCL2-associated X gene OS=[Eukaryota] Monodelphis domestica GN=BAX (length=603 residues).
atggacggctccggagagcagccgcgaggcgggggtgatctgggggccacaagctcggagcagatcatgaggaccggagc
cgtgctgctgcaggggtttatccaggaccgggcgggccgagtggcggggggtgcccccgagctgctcctggactccatgg
gggactcggccccgctgccttcagaccccaggaccaagcggcttaccgagtgcctgcggaggatcggggacgagctggac
agcaacatggagcttcagaggatgatcgccgcggtggagaccgactccccccgggaggtgttcttccgagtggcagccga
gatgttttccgatgggaacttcaactgggggcgggtggtggccctcttctattttgccagcaagctggtgctcaaggcgc
tttgcaccaaggtcccggagctgatccgaaccatagtgggctggaccctagatttcttgagagaacggctgctcacctgg
atccaggaacagggtggctgggacggcctcctctcttacttcgggacaccaacttggcagacagtgaccatcttcgtggc
tggcatcctcaccgcttcccttaccatctggaagatgtcctag
© 1998-2018