Dataset for CDS BAK1 of Organism Monodelphis domestica

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F6R4F6_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Monodelphis domestica GN=BAK1 (length=615 residues).
atggcttctaggcaggtgaaccgggttcgagccccatcatctactgcagaggaacaggtggcccgagagactgaagaggt
tttccgaagctatgtctactaccgccaccaacaagagcaggaaactgagggagaagctgtccctgcagacccagagatgg
ataccctaccccaagagctcagcagcaccaccgagcaggtgggccgacagcttgccgtcatcggggatgacatcagtcgt
aggtatgactcagaattcaaggccatgctgcagcatttgcagcccacccccgacactgcctatgagtacttcaccaagat
cgcctccagcctgtttgagagcggcatcaactggggccgagtggtggccctgctgggctttggctaccggttggcactac
atgtttatcagcggggcctgaccggcttcctgggccgagtggctcactttgtggctgatttcatgctccatcactgcatt
gcccgctggattgcccagaatgggggctgggtggcagccctgaacctcaccaacaactctatcttgtacgtggtgacagt
cttgggtgtggtcctctttgttcgcttcttgatccgaagattcttccaaccttga
© 1998-2018