Dataset for CDS BOK of Organism Mesocricetus auratus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A1U7QEC1_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Mesocricetus auratus GN=BOK (length=642 residues).
atggaggtgctgcggcgctcttctgtctttgctgcggagatcatggacgcctttgatcgctcgcccacagacaaggagct
ggtggcccaggccaaggcactaggccgggagtacgtgcacgcgcggcttttgcgcgccggcctctcctggagcgcaccag
agcgtacttcgcctgcccctggaggacggctagcggaggtgtgcaccgtgctgctgcgcttgggggatgagctggagcag
atccgtcccagtgtgtaccgcaacgtggccgggcagctgcgcatctccctgcagtctgagcctgtggtgactgacgcctt
ccttgctgtggcaggccacatcttctcagctggcatcacatggggcaaggtggtgtccctgtactcggtggctgcggggc
tggctgtggactgcgttcggcaggctcagcctgccatggttcatgccctggttgactgcctgggggaatttgtgcgcaag
accctggcgacctggcttcggaggcgtggcggatggaccgatgtcctcaagtgtgtggtcagcacagaccctggcttccg
ctcccactggctggtggccacgctctacagttttggccgcttcctgaaggctgcattcttcctgttgttgccagagagat
ga
© 1998-2018