Dataset for CDS BAX-like of Organism Mesocricetus auratus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A1U7QEC1_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Mesocricetus auratus GN=BOK (length=642 residues).
atggaggtgctgcggcgctcttctgtctttgctgcggagatcatggacgcctttgatcgctcgcccacagacaaggagct
ggtggcccaggccaaggcactaggccgggagtacgtgcacgcgcggcttttgcgcgccggcctctcctggagcgcaccag
agcgtacttcgcctgcccctggaggacggctagcggaggtgtgcaccgtgctgctgcgcttgggggatgagctggagcag
atccgtcccagtgtgtaccgcaacgtggccgggcagctgcgcatctccctgcagtctgagcctgtggtgactgacgcctt
ccttgctgtggcaggccacatcttctcagctggcatcacatggggcaaggtggtgtccctgtactcggtggctgcggggc
tggctgtggactgcgttcggcaggctcagcctgccatggttcatgccctggttgactgcctgggggaatttgtgcgcaag
accctggcgacctggcttcggaggcgtggcggatggaccgatgtcctcaagtgtgtggtcagcacagaccctggcttccg
ctcccactggctggtggccacgctctacagttttggccgcttcctgaaggctgcattcttcctgttgttgccagagagat
ga
>gnl|bcl2dbcds|A0A1U7R0G7_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Mesocricetus auratus GN=BAK1 (length=630 residues).
atggcatctggacaaggaccaggccctcctagggaggactgtgatgactccccctccccttctgaacagcaggtcgccca
ggacacagaggaggtctttcgaagctatgtttttcacctccaccagcaggagcaagagacccagggggcggctgcctctg
ccaaccccgagatggacaacttgctcctagaacccaacagcgtcttgggtcaagtgggtcggcagcttgctatcattgga
gacgacattaaccggagatacgacacagagttccagaacttactggagcagctgcagcccacagcggggaatgcctacga
gctcttcaccaagatcgcttccagcctatttaagagtggcatcagctggggccgtgtggtggctctcctgggctttggct
accgcctggccctgtacgtctaccagcgtggcttgaccggcttcctgggccaggtgacctgctttttggctgatatcata
ctgcaccattatatcgccaggtggatcgcacagagaggcggctgggtggcagccctgaatctgcgtagagaccccatcct
gagtgtggtgacaattctcggtgtggttctgttgggccagtacgtggtacacaagttcttcagatcctga
© 1998-2018