Dataset for CDS BOK of Organism Meleagris gallopavo

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G1MWK7_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Meleagris gallopavo GN=BOK (length=309 residues).
gcaccctctcttcttttcccaggcataacatggggcaaggtggtttctctctacgctgtggcagcggggctggcagtgga
ctgtgtgcgtcatgcacagccagccatggtccacaccatcgtggactgcctgggagagtttgtccgcaagaccttggtga
cgtggctgaagaggcgaggaggctgggcagacatcaccaagtgcgtggtcagcaccgaccccagtctccgctcccactgg
ctcgtggccgccatctgcagctttgggcacttcctcaaggccatcttcttcgtgttgctgcccgagaga
© 1998-2018