Dataset for CDS BAK1 of Organism Meleagris gallopavo

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|H9H1N7_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Meleagris gallopavo GN=BAK1 (length=348 residues).
gggacccacccaggggcccacggacgccggggcagcaatgggcgcaggccgtcacgagagaccaattcagaggaccaggt
ggcccagcagaccgaggaggtgttccggagctacaccttctaccgctaccagcaggagagagaggagggaggggaagagg
tgcccatggacccggagatcatggagatccagcaggagctgggcagcatcgggagccaggtgggcaggcgcctggccatc
atcggggacgacatcaacaagcggtacgacgcggagttccgccatatgctgaagtcattgcagcccaccaaggagaatgc
ctacgagtacttcaccaccatagcctcc
>gnl|bcl2dbcds|H9H1N7_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Meleagris gallopavo GN=BAK1 (length=456 residues).
gtggcctctttccaacctggggaaagcagcagccaagctgcccctctacttctctcccccttgcctctctcagaggacca
ggtggcccagcagaccgaggaggtgttccggagctacaccttctaccgctaccagcaggagagagaggagggaggggaag
aggtgcccatggacccggagatcatggagatccagcaggagctgggcagcatcgggagccaggtgggcaggcgcctggcc
atcatcggggacgacatcaacaagcggtacgacgcggagttccgccatatgctgaagtcattgcagcccaccaaggagaa
tgcctacgagtacttcaccaccatagcctccagtcaccgtccccttggcagcccttgcacgagctgtctgggggcagaag
ctttgggttgggaagcgtggccaagtggatgtcccagcaacagtgtgaagactgga
© 1998-2018