Dataset for CDS BOK of Organism Mandrillus leucophaeus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2K5YX79_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Mandrillus leucophaeus GN=BOK (length=1110 residues).
atgcgcagggaactggccaatgggaatgtcctggccccagcagagacaccaggctctgatctaactcagaacgccggact
ccctcagagcgccgcagcccatctcttgcacccgcagcacgccctgcactccagaggcttcctgcgagctgcatgtgttc
ggccccacctagttcctctggcctgtccacgccgtgccgtgccggtccacaccctgtccagcccactcaaaccatccaca
cccctgtacacactgacagctcagggccgctccggcctggtcgccttctccgggcgcatccagggaactcgctcggtcct
ccttaagcgggaggcgatcttaattagtgagatccagagcagctggctccggggaggggatgagggcgcctttatcggcc
agaatggtccgctttctctgcccagcccctccccacgtcgggctctggccgcctgcctggtccctcctgctctgggcagc
tcgactgcctgtcggctgggccaaggttgggggacggctcaagggaggtcagatggggttaagtggaggtgggaatcaga
caagttaagtcaggaacaggccggaattcaagcagggtcaggtggggtcaggtgcagggtgtgccccaagccagttgtgt
cccagggagctggggcgtgggctgtctctcactgcctttgtgaccacacaggggatgagctggagatgatccgacccagc
gtctaccgcaacgtggctcgtcagctgcacatctccctgcagtctgagcctgtggtgaccgatgcgttcctggccgtggc
tggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccctgtatgcggtggccgcggggctggccgtggact
gtgtgaggcaggcccagcctgccatggtccacgccctcgtggactgcctgggggagtttgtgcgcaagaccctggcaacc
tggctgcggagacgcggcggatggactgatgtcctcaagtgtgtggtcagcacagaccctggcctccgctcccactggct
ggtagccgcactctgcagcttcggccgcttcctgaaggctgccttcttcgtgctgctgccagagagatga
© 1998-2018