Dataset for CDS BAX-like of Organism Mandrillus leucophaeus

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A0A2K5XKG3_BAX-04 BCL2-associated X gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAX (length=609 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgaacagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggagacacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaggctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
gaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggtgaga
ctcctcaaccctcctcaccccaaccaccgcccctgccccactgtccctgcccacccccggtcacagtggtgccctctccc
catctttggatcatcagatgtggtctataatgcatttccttatgtgtct
>gnl|bcl2dbcds|A0A2K5XKG3_BAX-01 BCL2-associated X gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgaacagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggagacacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaggctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
gaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggc
ctcctctcctactttgggacgcccacgtggcagaccgtgaccatcttggtggctggagtactcaccgcctccctcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2K5XKG3_BAX-02 BCL2-associated X gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAX (length=432 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgaacagatcatgaagacaggggcccttttgct
tcaggggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacg
gcaacttcaactggggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtg
cccgaactgatcagaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccaggg
tggttgggacggcctcctctcctactttgggacgcccacgtggcagaccgtgaccatcttggtggctggagtactcaccg
cctccctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2K5XKG3_BAX-03 BCL2-associated X gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAX (length=555 residues).
atggacgggtccggggagcagcccagaggcgggggagtgacaccccgttctgattctgcaccctcactccatccccactc
taggcgaatggggggggagacacccgagctggccctggacccggtgcctcaggatgcgtccaccaagaggctgagcgagt
gtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgattgccgccgtggacacagactccccc
cgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactggggccgtgttgtcgcccttttcta
ctttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatcagaaccatcatgggctggacactgg
acttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggcctcctctcctactttgggacgccc
acgtggcagaccgtgaccatcttggtggctggagtactcaccgcctccctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2K5YIY6_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAK1 (length=519 residues).
atggcatcagggcaaggcccagggtttcccaagcaggagtgcggagagcttgccctgccctctgcttctgaggagcaggt
aacccgggacatggagaaggtttttgaccgccatcagcaggaacaggaggctgaaggcagcaccgtggggcaggtgggac
ggcggatcaccatgctgcaccacctgcagcccacagcagagaacgcctacgagtacttcaccaagatcgcctccagcctg
tttgagagtggcatcaaccagggccgtgtggtggctctcctgggcttcggctaccgtctggccctacatgtctaccagcg
cggcttgactggcttcctgggccaggtgacccgcttcgtggtctgcatgctgcaatactgcatcgcctggtggatcgcgc
agaggggcagctgggtggcagccctggacttgggcaatggtcccatcctgaacatgctggtgattctgggggtggttctg
ttgggcccgtttgtggtacaaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2K5YIY6_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAK1 (length=555 residues).
atggcatcagggcaaggcccagggtttcccaagcaggagtgcggagagcttgccctgccctctgcttctgaggagcaggt
aacccgggacatggagaaggtttttgaccgccatcagcaggaacaggaggctgaagggccagccgcccctgccgacccag
agatggtcaccttcagcaccgtggggcaggtgggacggcggatcaccatgctgcaccacctgcagcccacagcagagaac
gcctacgagtacttcaccaagatcgcctccagcctgtttgagagtggcatcaaccagggccgtgtggtggctctcctggg
cttcggctaccgtctggccctacatgtctaccagcgcggcttgactggcttcctgggccaggtgacccgcttcgtggtct
gcatgctgcaatactgcatcgcctggtggatcgcgcagaggggcagctgggtggcagccctggacttgggcaatggtccc
atcctgaacatgctggtgattctgggggtggttctgttgggcccgtttgtggtacaaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2K5YT59_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAK1 (length=390 residues).
gagcaggtagcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaagg
ggcggctgcccctgctgatccagagatggacaccttgcccctgcaacctagcagcaccatggggcaggtgggacggcagc
tcgccatcatcggggacgacatcaaccgacgctatgactcagagttccagaccatgctgcagcagctgcagcccacggca
gagaacgcctatgagtacttcaccaagattgcctccaggccagcagcaacacccacagcctgtttgagagtggcatcaac
tggggccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcacggcctga
>gnl|bcl2dbcds|A0A2K5YT59_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAK1 (length=636 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgctgatccagagatggacaccttgcccctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgctgcagcagctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccagcctgtttgagagtggcatcaactggggccgtgtggtggctcttctgggct
tcggctaccgtctggccctacacgtctaccagcacggcctgactggcttcctgggccaggtgacccgcttcgtggtcgac
ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggcagccctgaacttgggcaatggtcc
catcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2K5YT59_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAK1 (length=579 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcagaacccctctgccacgagccaaggcc
tggtgggacggcagctcgccatcatcggggacgacatcaaccgacgctatgactcagagttccagaccatgctgcagcag
ctgcagcccacggcagagaacgcctatgagtacttcaccaagattgcctccagcctgtttgagagtggcatcaactgggg
ccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcacggcctgactggcttcctgggcc
aggtgacccgcttcgtggtcgacttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggca
gccctgaacttgggcaatggtcccatcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacg
aagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2K5YX79_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Mandrillus leucophaeus GN=BOK (length=1110 residues).
atgcgcagggaactggccaatgggaatgtcctggccccagcagagacaccaggctctgatctaactcagaacgccggact
ccctcagagcgccgcagcccatctcttgcacccgcagcacgccctgcactccagaggcttcctgcgagctgcatgtgttc
ggccccacctagttcctctggcctgtccacgccgtgccgtgccggtccacaccctgtccagcccactcaaaccatccaca
cccctgtacacactgacagctcagggccgctccggcctggtcgccttctccgggcgcatccagggaactcgctcggtcct
ccttaagcgggaggcgatcttaattagtgagatccagagcagctggctccggggaggggatgagggcgcctttatcggcc
agaatggtccgctttctctgcccagcccctccccacgtcgggctctggccgcctgcctggtccctcctgctctgggcagc
tcgactgcctgtcggctgggccaaggttgggggacggctcaagggaggtcagatggggttaagtggaggtgggaatcaga
caagttaagtcaggaacaggccggaattcaagcagggtcaggtggggtcaggtgcagggtgtgccccaagccagttgtgt
cccagggagctggggcgtgggctgtctctcactgcctttgtgaccacacaggggatgagctggagatgatccgacccagc
gtctaccgcaacgtggctcgtcagctgcacatctccctgcagtctgagcctgtggtgaccgatgcgttcctggccgtggc
tggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccctgtatgcggtggccgcggggctggccgtggact
gtgtgaggcaggcccagcctgccatggtccacgccctcgtggactgcctgggggagtttgtgcgcaagaccctggcaacc
tggctgcggagacgcggcggatggactgatgtcctcaagtgtgtggtcagcacagaccctggcctccgctcccactggct
ggtagccgcactctgcagcttcggccgcttcctgaaggctgccttcttcgtgctgctgccagagagatga
© 1998-2018