Dataset for CDS BAK1 of Organism Mandrillus leucophaeus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A2K5YIY6_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAK1 (length=519 residues).
atggcatcagggcaaggcccagggtttcccaagcaggagtgcggagagcttgccctgccctctgcttctgaggagcaggt
aacccgggacatggagaaggtttttgaccgccatcagcaggaacaggaggctgaaggcagcaccgtggggcaggtgggac
ggcggatcaccatgctgcaccacctgcagcccacagcagagaacgcctacgagtacttcaccaagatcgcctccagcctg
tttgagagtggcatcaaccagggccgtgtggtggctctcctgggcttcggctaccgtctggccctacatgtctaccagcg
cggcttgactggcttcctgggccaggtgacccgcttcgtggtctgcatgctgcaatactgcatcgcctggtggatcgcgc
agaggggcagctgggtggcagccctggacttgggcaatggtcccatcctgaacatgctggtgattctgggggtggttctg
ttgggcccgtttgtggtacaaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2K5YIY6_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAK1 (length=555 residues).
atggcatcagggcaaggcccagggtttcccaagcaggagtgcggagagcttgccctgccctctgcttctgaggagcaggt
aacccgggacatggagaaggtttttgaccgccatcagcaggaacaggaggctgaagggccagccgcccctgccgacccag
agatggtcaccttcagcaccgtggggcaggtgggacggcggatcaccatgctgcaccacctgcagcccacagcagagaac
gcctacgagtacttcaccaagatcgcctccagcctgtttgagagtggcatcaaccagggccgtgtggtggctctcctggg
cttcggctaccgtctggccctacatgtctaccagcgcggcttgactggcttcctgggccaggtgacccgcttcgtggtct
gcatgctgcaatactgcatcgcctggtggatcgcgcagaggggcagctgggtggcagccctggacttgggcaatggtccc
atcctgaacatgctggtgattctgggggtggttctgttgggcccgtttgtggtacaaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2K5YT59_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAK1 (length=390 residues).
gagcaggtagcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaagg
ggcggctgcccctgctgatccagagatggacaccttgcccctgcaacctagcagcaccatggggcaggtgggacggcagc
tcgccatcatcggggacgacatcaaccgacgctatgactcagagttccagaccatgctgcagcagctgcagcccacggca
gagaacgcctatgagtacttcaccaagattgcctccaggccagcagcaacacccacagcctgtttgagagtggcatcaac
tggggccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcacggcctga
>gnl|bcl2dbcds|A0A2K5YT59_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAK1 (length=636 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgctgatccagagatggacaccttgcccctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgctgcagcagctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccagcctgtttgagagtggcatcaactggggccgtgtggtggctcttctgggct
tcggctaccgtctggccctacacgtctaccagcacggcctgactggcttcctgggccaggtgacccgcttcgtggtcgac
ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggcagccctgaacttgggcaatggtcc
catcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2K5YT59_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAK1 (length=579 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcagaacccctctgccacgagccaaggcc
tggtgggacggcagctcgccatcatcggggacgacatcaaccgacgctatgactcagagttccagaccatgctgcagcag
ctgcagcccacggcagagaacgcctatgagtacttcaccaagattgcctccagcctgtttgagagtggcatcaactgggg
ccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcacggcctgactggcttcctgggcc
aggtgacccgcttcgtggtcgacttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggca
gccctgaacttgggcaatggtcccatcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacg
aagattcttcaaatcatga
© 1998-2018