Dataset for CDS Unclassified of Organism Macrobrachium olfersii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A223FZ31_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Macrobrachium olfersii (length=1425 residues).
atggccatcaatactccacatggtgagaaagctgttcagagaccatctgcatccaaggatggcgatgatacctctgagga
gactcaaaacgctgcaagtgggccccagcatgaaacttccaatgatgatttcaggggcagtggaaccatatcaagcctta
gtagtcaggagaacttgccttcagctctctcatcaccttttcaagcttcgcctctaccctcacctagtcagcgtcactca
tttaacccatccccatcacagttagaatctcctttgtcatctccatacctacagccatctctgctttcatcatcttcttc
acttcaatctcctcctggatcacttccatctccttatgaaagaggcaataatatatccatagaacaactcaatgaattgg
ctttacaagatagtgagaacaataatgtagatgaaaatagtaaccaaggttttgaccagtatgctggagttgcccacggt
tatgcaccagatcaatctgtaagacctcgtgtaagagcacagtattcaagtggaagagaccagccagacagggcccctat
taacattgaagcaagaccactaatgagaagaagaagcagtagcagtggtagtttttcacataggaggaatttgtccgaag
atctagcttgctcacccactacaaatttttcatatttcgatgatgactcagcgcaagagtatgacaggttaccaagactc
ccaaattatcagccagatcggagagattcatggtgcagcccccagcccttaccccccagagaagacccatcattctttca
gtctgtgacaagaatcctgcctttaaacttaagaggtggtgggtacggaccccagccaccaccactagatgatactatag
aagatgatgctcaagatttattaagcaactttacttctgaaactctacttagaaatcgtcttccgaaccccagcacagcc
attataccacaagggtatcgcaatccagccttatatagagttggacaggaactcaggaaattagctgatgcatttgctga
aacagcggaacgcaggaatgtgcaacgtatggcggagtctgttcacctggagagcatcaatatggaaaattttttccagc
tctgcactgaattatttatgggaggaataactcgagaacgtatagttgcattatttacttttgtgggagatgttgcagtc
tttcatgtgcggcgccaaggacagcagtttcttcaggtgctaatgacgtggtcatggaagtatttagtagatcacatttg
cagatgggtaaaggaagctggtggttggggtgcagttttgagcagaggagctaatgcactgtatacaactgctgtttttg
tcttttgtcttattggaacagttgctgctggtgtgtatattgttaaaaccttgaaagactggtaa
© 1998-2018