Dataset for CDS BAX-like of Organism Macaca mulatta

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A1D5QI80_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Macaca mulatta GN=BAK1 (length=561 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcacaccatggggcaggtgggacggcagctcg
ccatcatcggggacgacatcaacagacgctatgactcagagttccagaccatgctgcagcacctgcagcccacggcagag
aacgcctatgagtacttcaccaagattgcctccagcctgtttgagagtggcatcaactggggccgtgtggtggctcttct
gggcttcggctaccgtctggccctacacgtctaccagcacggcctgactggcttcctgggccaggtgacccgcttcgtgg
tcgacttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggcagccctgaacttgggcaat
ggtcccatcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatg
a
>gnl|bcl2dbcds|A0A1D5QI80_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Macaca mulatta GN=BAK1 (length=462 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggacaccttgcccctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaacagacgctatgactcagagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccaggccagcagcaacacccacagcctgtttgagagtggcatcaactggggccg
tgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcacggcctga
>gnl|bcl2dbcds|A0A1D5QI80_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Macaca mulatta GN=BAK1 (length=579 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcagaacccctctgccatgagccaaggcc
tggtgggacggcagctcgccatcatcggggacgacatcaacagacgctatgactcagagttccagaccatgctgcagcac
ctgcagcccacggcagagaacgcctatgagtacttcaccaagattgcctccagcctgtttgagagtggcatcaactgggg
ccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcacggcctgactggcttcctgggcc
aggtgacccgcttcgtggtcgacttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggca
gccctgaacttgggcaatggtcccatcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacg
aagattcttcaaatcatga
>gnl|bcl2dbcds|A0A1D5QZS9_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Macaca mulatta GN=BAK1 (length=492 residues).
atggcatcagggcaaggcccagggtttcccaggcaggagtgcagagagcttgccttgccctctgcttctgaggagcaggt
aacccgggacatggagaaggtttttgaccgccatcagcaagaacaggagagatggtcacctagcagcaccgtggggcagg
tgggatggcagatcaccatgctgcagcacctgcagcccacagcagagaacgcctatgagtacttcaccaagatcgcctcc
agcctgtttgagagtggcatcaaccagggccgtgtggtggctctcctgggcttcggctaccatctggtcctacatgtcta
ccagcgcggcttgactggcttcctgggccaggtgacccgcttcgtggtcttcatgctgagcagctgggtggcagccctgg
acttgggcaatggtcccatcctgaacgtgctggtgattctgggggtggttctgttgggcctgtttgtggtacaaggattc
ttcaaatcatga
>gnl|bcl2dbcds|F6ZV71_BAX-02 BCL2-associated X gene OS=[Eukaryota] Macaca mulatta GN=BAX (length=558 residues).
atggacgggtccggggagcagcccagaggcgggggtgaggcgggaggcagacgggcgggaggaggtttcatccaggatcg
agcagggcgaatggggggggagacacccgagctggccctggacccggtgcctcaggatgcgtccaccaagaggctgagcg
agtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgattgccgccgtggacacagactcc
ccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactggggccgtgttgtcgccctttt
ctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatcagaaccatcatgggctggacgc
tggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggcctcctctcctactttgggacg
cccacgtggcagaccgtgaccatcttggtggctggagtactcaccgcctccctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|F6ZV71_BAX-01 BCL2-associated X gene OS=[Eukaryota] Macaca mulatta GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggagacacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaggctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
gaaccatcatgggctggacgctggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggc
ctcctctcctactttgggacgcccacgtggcagaccgtgaccatcttggtggctggagtactcaccgcctccctcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|F6ZV71_BAX-03 BCL2-associated X gene OS=[Eukaryota] Macaca mulatta GN=BAX (length=597 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggagacacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaggctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
gaaccatcatgggctggacgctggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggtgaga
ctcctcaaccctcctcaccccaaccaccgcccctgccccactgtccctgcccacccccggtcacagtggtgccctctccc
catcttcggatcgtcagatgtggtctataatgcattt
© 1998-2018