Dataset for CDS BAX of Organism Macaca mulatta

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|F6ZV71_BAX-02 BCL2-associated X gene OS=[Eukaryota] Macaca mulatta GN=BAX (length=558 residues).
atggacgggtccggggagcagcccagaggcgggggtgaggcgggaggcagacgggcgggaggaggtttcatccaggatcg
agcagggcgaatggggggggagacacccgagctggccctggacccggtgcctcaggatgcgtccaccaagaggctgagcg
agtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgattgccgccgtggacacagactcc
ccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactggggccgtgttgtcgccctttt
ctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatcagaaccatcatgggctggacgc
tggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggcctcctctcctactttgggacg
cccacgtggcagaccgtgaccatcttggtggctggagtactcaccgcctccctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|F6ZV71_BAX-03 BCL2-associated X gene OS=[Eukaryota] Macaca mulatta GN=BAX (length=597 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggagacacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaggctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
gaaccatcatgggctggacgctggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggtgaga
ctcctcaaccctcctcaccccaaccaccgcccctgccccactgtccctgcccacccccggtcacagtggtgccctctccc
catcttcggatcgtcagatgtggtctataatgcattt
>gnl|bcl2dbcds|F6ZV71_BAX-01 BCL2-associated X gene OS=[Eukaryota] Macaca mulatta GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggagacacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaggctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
gaaccatcatgggctggacgctggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggc
ctcctctcctactttgggacgcccacgtggcagaccgtgaccatcttggtggctggagtactcaccgcctccctcaccat
ctggaagaagatgggctga
© 1998-2018