Dataset for CDS BOK of Organism Macaca fascicularis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2K5X835_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Macaca fascicularis GN=BOK (length=639 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggatgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctgggccgggagtacgtgcacgcgcggctactgcgcgccggcctctcctggagcgcgccgg
agcgcgccgcgcctgtcccgggacgcctggccgaggtgtgcgcggtgctcctgcgcctgggggatgagctggagatgatc
cggcccagcgtctaccgcaacgtggctcgtcagctgcacatctccctgcagtctgagcctgtggtgaccgatgcgttcct
ggccgtggctggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccctgtatgcggtggccgcggggctgg
ctgtggactgtgtgaggcaggcccagcctgccatggtccacgctctcgtggactgcctgggggagtttgtgcgcaagacc
ctggcaacctggctgcggagacgcggcggatggactgatgtcctcaagtgtgtggtcagcacagaccctggcctccgctc
ccactggctggtagccgcactctgcagcttcggccgcttcctgaaggctgccttcttcgtgctgctgccagagagatga
© 1998-2018