Dataset for CDS BAK1 of Organism Macaca fascicularis

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A2K5UMQ3_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Macaca fascicularis GN=BAK1 (length=636 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggacaccttgcccctgcaacctagcagcaccatggggcaggtgggacggcagctggccatc
atcggggacgacatcaacagacgctatgactcagagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccagcctgtttgagagtggcatcaactggggccgtgtggtggctcttctgggct
tcggctaccgtctggccctacacgtctaccagcacggcctgactggcttcctgggccaggtgacccgcttcgtggtcgac
ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggcagccctgaacttgggcaatggtcc
catcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2K5UMQ3_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Macaca fascicularis GN=BAK1 (length=462 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggacaccttgcccctgcaacctagcagcaccatggggcaggtgggacggcagctggccatc
atcggggacgacatcaacagacgctatgactcagagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccaggccagcagcaacacccacagcctgtttgagagtggcatcaactggggccg
tgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcacggcctga
>gnl|bcl2dbcds|A0A2K5VC37_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Macaca fascicularis GN=BAK1 (length=471 residues).
atggcatcagggcaaggcccagggtttcccaggcaggagtgcagagagcttgccttgccctctgcttctgaggagcaggt
aacccgggacatggagaaggtttttgaccgccatcagcaagaacaggagagatggtcacctagcagcaccgtggggcagg
tgggatggcagatcaccatgctgcagcacctgcagcccacagcagagaacgcctatgagtacttcaccaagatcgcctcc
agcctgtttgagagtggcatcaaccagggccgtgtggtggctctcctgggcttcggctaccatctggtcctacatgtcta
ccagcgcggcttgactggcttcctgggccaggtgacccgcttcgtggtggccgccctggacttgggcaatggtcccatcc
tgaacgtgctggtgattctgggggtggttctgttgggcctgtttgtggtacaaggattcttcaaatcatga
© 1998-2018