Dataset for CDS Unclassified of Organism Lubomirskia baicalensis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q1RPT5_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Lubomirskia baicalensis (length=735 residues).
atgtctggagatcagaagacggcgtatagggcggtttctattacagacctagaaagcgatgaggaagagacgaaaaacgt
ccttttcagctacgtgtgcatcaaagccaaggatgacaaagccttggagaaagaacaggtccagaccttggtggaaagcg
ttgaaaagcaggttatacacaccgctctcgcgtcgtccatggcgtccgaggtaggaaggagactcgccgaatttggggat
caagtggacggccagttctaccaggagatggaggaaatcgttgagttgactggaaccccggagaaagcgttcgccatctt
cagtgacgttgtcaagaatttgttcgaatgggatgagaacgggctaccaaagatcaacttgggacggattgctgcccttc
tcggctactgctaccatctgtgtcgcaagtttgttcagcagaaggcgggcgccttcacgctggtgtcgttcctcggcatg
gtggggacctggctagtcaagtttcctcatccaggcaaggttctacgaatggctgaagcagaagggaggatggggtcagc
tgctcatggctccagtgaacagtgggatcgctcgggtccagaatacgcttggcatccacacttttctgattatgggtgtg
gcgagtctcgccatttggggatatttcatgatgagaaagtgatcagaatattgtctgattcattatcggagccaaactta
atttatatcctgtga
© 1998-2018