Dataset for CDS BOK of Organism Loxodonta africana

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|G3UCC8_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Loxodonta africana GN=BOK (length=585 residues).
atggaggtcctgcggcgctcctcggtcttcgccgccgagatcatggacgcttttgaccgctctcccaccgacagagctgt
tgcccaggccaaggcgctcgggcgtttcgtacactcgcggctgctgcgcgccggcctggcctggctggccgaggtgtgcg
ccgtactgctgcgcctgggggatgagctggagctgatccggcccagcgtctaccgcaacgtggcacggcagctgaacctc
tccctgcagtccgagaccgtggtgaccgacgcctttctggctgtggccacacagatcttctctgcaggggcaaggtgggg
gtcactgtatgctgtggcttgcgggctggctgtggactgccagcggcagatcaagcctgtcattcacgccttcgtggact
gcctggagaaattcgtgcgcaagatcctggccccatggctgcggaggcgcggcggatggactgatgtcctcaagtgcgtg
gtcagcacggaccctggcctccgctcccactggctggtggctgcgttctgcagctttggccgcttcctgaaggctgcctt
cttcatgctgttgccggagagatga
>gnl|bcl2dbcds|G3UCC8_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Loxodonta africana GN=BOK (length=630 residues).
atggaggtcctgcggcgctcctcggtcttcgccgccgagatcatggacgcttttgaccgctctcccaccgacagagctgt
tgcccaggccaaggcgctcgggcgtgagttcgtacactcgcggctgctgcgcgccggcctggcctggagcgcgccggagc
gcgccgcgcccccgggcggccgcctggccgaggtgtgcgccgtactgctgcgcctgggggatgagctggagctgatccgg
cccagcgtctaccgcaacgtggcacggcagctgaacctctccctgcagtccgagaccgtggtgaccgacgcctttctggc
tgtggccacacagatcttctctgcaggtatctcgtgggggaggtgggggtcactgtatgctgtggcttgcgggctggctg
tggactgccagcggcagatcaagcctgtcattcacgccttcgtggactgcctggagaaattcgtgcgcaagatcctggcc
ccatggctgcggaggcgcggcggatggactgatgtcctcaagtgcgtggtcagcacggaccctggcctccgctcccactg
gctggtggctgcgttctgcagctttggccgcttcctgaaggctgccttcttcatgctgttgccggagaga
© 1998-2018