Dataset for CDS BAX-like of Organism Loxodonta africana

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|G3SNK6_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Loxodonta africana GN=BAK1 (length=633 residues).
atggcatctgggcaaggcccgggtcctcccgggcaggactgtggagactctactccaccctccacttctgaggtgcaggt
agccagggacgcggaggatgttttccgcagttacgtcttttaccgccatcagcaggagcaggaggccgaaggggcggcca
cacccgctgacccggagatggtctccttgcccctggagcctaacagtgtcatggggcaggtgggtcggcagcttgccatc
atcggggatgatatcaaccggcgctacgatgtggagttccagaccatgttgcagcacctgcagccaacaccacagaacgc
ttcccagtacttcatcaagattgcctcgagcctgtttgagagcggcatcaactggggccgcgtggtggctctcctaggct
ttggctatcgcctggccttgcacgtctaccagcatggcctgactggcttcctgggccacgtgaccagcttcgtggcagat
ttcatgctgaagcactgcatcgcccggtggattgcacagaggggcggctgggttgcagccctggacttaggcaatggtcc
catccggaatgtgctgatagctctggctgtggttctgttgggccagtatgtggtacgaagattctgggatccc
>gnl|bcl2dbcds|G3SQJ6_BAX-02 BCL2-associated X gene OS=[Eukaryota] Loxodonta africana GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccaactctgagcacatcatgaagacgggggcccttttgct
tcagggtttcatccaggatcgagcaaagcagatgggaggggagacgcctgagctggccctggagcgggtgccccaggatc
catccacgaagaagctgagcgagtgtctcaagcgcatcggggacgaattggacagtaacttagagctgcagaggatgatt
gcagctgtggacacagactctccccgtgaagtctttttccgagtggcagcagagatgttttccgatggcaacttcaactg
gggccgggttgttgcccttttctactttgccagcaaactggtgctcaaggtgggcggatgtagaacagtggaaaggagag
agacagttgtaggccggtgtctgctccttattcatttattcattcagcaaactttccaaggagcacctggtagggatggc
ctcctctcctactttgggacccccacgtggcagacagtgaccatcttcgtggctggcgtgctcactgcctcactcaccat
ctggaagaaaatgggctga
>gnl|bcl2dbcds|G3SQJ6_BAX-01 BCL2-associated X gene OS=[Eukaryota] Loxodonta africana GN=BAX (length=600 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccaactctgagcacatcatgaagacgggggcccttttgct
tcagggtttcatccaggatcgagcaaagcagatgggaggggagacgcctgagctggccctggagcgggtgccccaggatc
catccacgaagaagctgagcgagtgtctcaagcgcatcggggacgaattggacagtaacttagagctgcagaggatgatt
gcagctgtggacacagactctccccgtgaagtctttttccgagtggcagcagagatgttttccgatggcaacttcaactg
gggccgggttgttgcccttttctactttgccagcaaactggtgctcaagaaatatgggaagctcaaggagttgagagaac
agataattaatcatagggtcttgcccccagtgacctctgacttctccttggcccctctgctacttcttccctgcccctgg
ctgccatgtggagaagatggcctcctctcctactttgggacccccacgtggcagacagtgaccatcttcgtggctggcgt
gctcactgcctcactcaccatctggaagaaaatgggctga
>gnl|bcl2dbcds|G3UCC8_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Loxodonta africana GN=BOK (length=585 residues).
atggaggtcctgcggcgctcctcggtcttcgccgccgagatcatggacgcttttgaccgctctcccaccgacagagctgt
tgcccaggccaaggcgctcgggcgtttcgtacactcgcggctgctgcgcgccggcctggcctggctggccgaggtgtgcg
ccgtactgctgcgcctgggggatgagctggagctgatccggcccagcgtctaccgcaacgtggcacggcagctgaacctc
tccctgcagtccgagaccgtggtgaccgacgcctttctggctgtggccacacagatcttctctgcaggggcaaggtgggg
gtcactgtatgctgtggcttgcgggctggctgtggactgccagcggcagatcaagcctgtcattcacgccttcgtggact
gcctggagaaattcgtgcgcaagatcctggccccatggctgcggaggcgcggcggatggactgatgtcctcaagtgcgtg
gtcagcacggaccctggcctccgctcccactggctggtggctgcgttctgcagctttggccgcttcctgaaggctgcctt
cttcatgctgttgccggagagatga
>gnl|bcl2dbcds|G3UCC8_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Loxodonta africana GN=BOK (length=630 residues).
atggaggtcctgcggcgctcctcggtcttcgccgccgagatcatggacgcttttgaccgctctcccaccgacagagctgt
tgcccaggccaaggcgctcgggcgtgagttcgtacactcgcggctgctgcgcgccggcctggcctggagcgcgccggagc
gcgccgcgcccccgggcggccgcctggccgaggtgtgcgccgtactgctgcgcctgggggatgagctggagctgatccgg
cccagcgtctaccgcaacgtggcacggcagctgaacctctccctgcagtccgagaccgtggtgaccgacgcctttctggc
tgtggccacacagatcttctctgcaggtatctcgtgggggaggtgggggtcactgtatgctgtggcttgcgggctggctg
tggactgccagcggcagatcaagcctgtcattcacgccttcgtggactgcctggagaaattcgtgcgcaagatcctggcc
ccatggctgcggaggcgcggcggatggactgatgtcctcaagtgcgtggtcagcacggaccctggcctccgctcccactg
gctggtggctgcgttctgcagctttggccgcttcctgaaggctgccttcttcatgctgttgccggagaga
© 1998-2018