Dataset for CDS BAX of Organism Loxodonta africana

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|G3SQJ6_BAX-02 BCL2-associated X gene OS=[Eukaryota] Loxodonta africana GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccaactctgagcacatcatgaagacgggggcccttttgct
tcagggtttcatccaggatcgagcaaagcagatgggaggggagacgcctgagctggccctggagcgggtgccccaggatc
catccacgaagaagctgagcgagtgtctcaagcgcatcggggacgaattggacagtaacttagagctgcagaggatgatt
gcagctgtggacacagactctccccgtgaagtctttttccgagtggcagcagagatgttttccgatggcaacttcaactg
gggccgggttgttgcccttttctactttgccagcaaactggtgctcaaggtgggcggatgtagaacagtggaaaggagag
agacagttgtaggccggtgtctgctccttattcatttattcattcagcaaactttccaaggagcacctggtagggatggc
ctcctctcctactttgggacccccacgtggcagacagtgaccatcttcgtggctggcgtgctcactgcctcactcaccat
ctggaagaaaatgggctga
>gnl|bcl2dbcds|G3SQJ6_BAX-01 BCL2-associated X gene OS=[Eukaryota] Loxodonta africana GN=BAX (length=600 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccaactctgagcacatcatgaagacgggggcccttttgct
tcagggtttcatccaggatcgagcaaagcagatgggaggggagacgcctgagctggccctggagcgggtgccccaggatc
catccacgaagaagctgagcgagtgtctcaagcgcatcggggacgaattggacagtaacttagagctgcagaggatgatt
gcagctgtggacacagactctccccgtgaagtctttttccgagtggcagcagagatgttttccgatggcaacttcaactg
gggccgggttgttgcccttttctactttgccagcaaactggtgctcaagaaatatgggaagctcaaggagttgagagaac
agataattaatcatagggtcttgcccccagtgacctctgacttctccttggcccctctgctacttcttccctgcccctgg
ctgccatgtggagaagatggcctcctctcctactttgggacccccacgtggcagacagtgaccatcttcgtggctggcgt
gctcactgcctcactcaccatctggaagaaaatgggctga
© 1998-2018