Dataset for CDS BAK1 of Organism Loxodonta africana

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G3SNK6_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Loxodonta africana GN=BAK1 (length=633 residues).
atggcatctgggcaaggcccgggtcctcccgggcaggactgtggagactctactccaccctccacttctgaggtgcaggt
agccagggacgcggaggatgttttccgcagttacgtcttttaccgccatcagcaggagcaggaggccgaaggggcggcca
cacccgctgacccggagatggtctccttgcccctggagcctaacagtgtcatggggcaggtgggtcggcagcttgccatc
atcggggatgatatcaaccggcgctacgatgtggagttccagaccatgttgcagcacctgcagccaacaccacagaacgc
ttcccagtacttcatcaagattgcctcgagcctgtttgagagcggcatcaactggggccgcgtggtggctctcctaggct
ttggctatcgcctggccttgcacgtctaccagcatggcctgactggcttcctgggccacgtgaccagcttcgtggcagat
ttcatgctgaagcactgcatcgcccggtggattgcacagaggggcggctgggttgcagccctggacttaggcaatggtcc
catccggaatgtgctgatagctctggctgtggttctgttgggccagtatgtggtacgaagattctgggatccc
© 1998-2018