Dataset for CDS Unclassified of Organism Lottia gigantea

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|V3ZQS5_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Lottia gigantea (length=636 residues).
atggcatctgtagtgatgccgcagagtttttgtaccaagcgaagaaacagtcagacattagcccctctgataatgccacc
cagagacgtgcagtttccatcagattacgacgatgtagctgaagaagggaaaatgttgttcaatagatttgttttatttc
gtatggaacaggagcaagttgaagataataaacaacaggctgcaatatcagatgaaacatatattgatcctatgtggata
aaagctggtagagaattaaggataatggctgatgaatttgctagaaccagaagtagagaagagattggtgtagaaaatat
aacatatgaacaatttaaagaattactatcagaattatttagtcagggacatatcactaaggaacgtgtaatgatgttgt
ttttcttctgttctgatgtggctgtaagaacagtgtcctgtagtgtagaaatgtgtaaacgctttatgcactggtctcta
acatttattactcaatgtgtatgtagatgggtcagagaaaatggcggttgggaagatgttttagtagtagatagaatgcc
aactctaagacccgttctggctgctggtgctgtctgttgcgtagtatattttgctgttaaatactataagtcctag
>gnl|bcl2dbcds|V4A486_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Lottia gigantea (length=384 residues).
atgacgttcaaggtacgattaaaaccttcagatgatgaactctctaattttgtggcaactgctggtgaaacattggaaaa
acactaccctcatgtttattcggatgttagtcggaaaatggcaacgactatgagttcacctgaggtggtgaaatcagcta
taactacaatattagaagcaatatttcgctgtgatataaactggggaaaactattatcattattagcaataacaagttca
tttgccttggagtgtgttttacaaggtcatgctgaatatgtggacaatctagtagagtgtgtagtgtattttgtatccta
taatatcaatgaatggttacaggtacaaggcggctgggtaggtatattattacttataagctag
© 1998-2018