Dataset for CDS BOK of Organism Lithobates catesbeiana

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|C1C4H5_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Lithobates catesbeiana GN=BOK (length=639 residues).
atgctgcgtcgctcttctgtttttgctgcagaagtatttgaggtgtttgacagatccccaactgacgaggagctggtagc
acaggggaaagcattgtgcagagactttatccaggcccgactccagcgtgctggtcttggatggaacaaaccagaacatg
ggatctcttcttcagtaggaggacgtatggcggaggtatcagccaccttcctgaggctaggggatgagttggagtacatg
agaccagcagtatacaggaacattgcccgacagctgaacatctccctgtcttcagagaccgttctgtctgatgctttgct
ggcggttgcctcagagatattcacagcaggtattacatgggggaaagtggtatctctatatgcagtagcagcaggccttg
caatggactgtgtgaaacactctcagcctgctcttgttctaaccattgtagactgtgtgggagagtttatacgaacaacc
ctggtcacgtggctgaagaggagaggaggatggacagatgtaacaaagtgtgttatcacttctgagtctagcctgcgatc
ccactggttggtctccagcgcctacaacgtaggacacttcttaaaggcagtgatattctttctgcttcgtgaacgataa
© 1998-2018