Dataset for CDS Unclassified of Organism Lepisosteus oculatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5M3E7_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Lepisosteus oculatus (length=603 residues).
gagagcagcgaggctgggggcgcgggggggctgcgtcaccccgaccccctggtgagggagggctacctgttgtcctacga
ctacatcagctacgtgacggggctggcgccacgctcccgccccccccccacggaggcggcggccgcgctgaggcacgccg
gggacgacctgctcctcaagttccccatcttcttccggcgctggccacgcctcttccagggcgtcaccgcggagaccgcc
tgccccacgctgctccgcatcctggacgagcacttccggccccggccccccgggggccgcccccgcgagctggcctggag
cgcggtgctgtccgtctacgtgctggcggggcagatggcgctgcactgccaggacagaggcatgatgggagtgctgccca
ggctgcagcagtgcgtgggggagtacgtggagagggtgatctgcccagcgatccggcggcagggaggctggtctggcttc
acctcccgctactgcaggaagcaggatctggagagccaggtgtggcgagtgtgcgggtggactctgctgctcttgatgac
cagcctcctctcctacctgctgtggaaacgcaaacttgcatag
© 1998-2018