Dataset for CDS BOK of Organism Lepisosteus oculatus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|W5MHB6_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Lepisosteus oculatus GN=BOK (length=666 residues).
ctggaggggatggaggtgctgcgcaggtcttcggtgtttgctgctgaagtaatggaggtgtttgaccgctcccccacgga
caaggagctggtctcccaggccaaggcgctctgcagggaatacatccactcccggctgaaccgagcgggactaggctggt
ccaaaccagagcatgcggcccacggggaggtgtcctccgtcctgctgtggctcggcgatgagctggaatacctgcgaccc
aacatttaccggaatgtggcgagacaactcagcatcactgtggcctcggagaacattgtgtcagatgccttcctggccgt
agctgcagagatcttcagcactgaaattgccaagaaagcagcagtaaaggggaagtgtataacgtgggggaaggtggtat
ctctgtacgcagtggctggaggtctggcggtggactgcgtgcgtcatggacacccagccatggtcgataccattgtggac
tgcctgggcgagtttgtgcgcaagagcctggtcgaatggctgaggagaaggggtggatgggctgacgtcacaaagtgtgt
agtgaacactgacccccgtctccggtctcactggctaatctctgctgcctgtacctgtggtcacttcgtcaaaaccgtgg
tcttctaccttctgcgagagcgctga
>gnl|bcl2dbcds|W5MHB6_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Lepisosteus oculatus GN=BOK (length=624 residues).
atggaggtgctgcgcaggtcttcggtgtttgctgctgaagtaatggaggtgtttgaccgctcccccacggacaaggagct
ggtctcccaggccaaggcgctctgcagggaatacatccactcccggctgaaccgagcgggactaggctggtccaaaccag
agcatgcggcccacggggaggtgtcctccgtcctgctgtggctcggcgatgagctggaatacctgcgacccaacatttac
cggaatgtggcgagacaactcagcatcactgtggcctcggagaacattgtgtcagatgccttcctggccgtagctgcaga
gatcttcagcactggtataacgtgggggaaggtggtatctctgtacgcagtggctggaggtctggcggtggactgcgtgc
gtcatggacacccagccatggtcgataccattgtggactgcctgggcgagtttgtgcgcaagagcctggtcgaatggctg
aggagaaggggtggatgggctgacgtcacaaagtgtgtagtgaacactgacccccgtctccggtctcactggctaatctc
tgctgcctgtacctgtggtcacttcgtcaaaaccgtggtcttctaccttctgcgagagcgctga
© 1998-2018