Dataset for CDS BAX-like of Organism Lepisosteus oculatus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|W5MCT6_BAX-01 BCL2-associated X gene OS=[Eukaryota] Lepisosteus oculatus GN=BAX (length=621 residues).
atggcagattctaccggaagcaaccagggtaacgagatagatgaaaacggagcagttggtggtgaagatactgttgatga
tgtaatcattgaacaaggagctgttgtttttcgaggatatgttgtagaggcagctcgtgtggataaccaagaatttgtca
ttgctccggaggatttaggagggagaccaaatgaaggacaggacagtcaagtgaaagacattgtaagaaatttaattgaa
atagctgatgagctgaatagaaatgctgaactggaaagtcttctcagcagggttgagtttgactcggcagagagtttgtt
tttcactgtggcaaggaagatttttgaagacggtattaactggggacgagtggtggctctttttcacttggcttacaaac
ttataatcaaggcaatcacaagagaccgcaatgagattattcaaacgatcattggctgggtattaaatttcattggagaa
cacgtttcacgctggatcagagagcatggaggatgggagggtgtccggaattattcccagaatctgaggtggcagaatgt
ggctatatttgctgctgcagttctcacaggtgtcttggcatactggaagatgtccagctga
>gnl|bcl2dbcds|W5MHB6_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Lepisosteus oculatus GN=BOK (length=666 residues).
ctggaggggatggaggtgctgcgcaggtcttcggtgtttgctgctgaagtaatggaggtgtttgaccgctcccccacgga
caaggagctggtctcccaggccaaggcgctctgcagggaatacatccactcccggctgaaccgagcgggactaggctggt
ccaaaccagagcatgcggcccacggggaggtgtcctccgtcctgctgtggctcggcgatgagctggaatacctgcgaccc
aacatttaccggaatgtggcgagacaactcagcatcactgtggcctcggagaacattgtgtcagatgccttcctggccgt
agctgcagagatcttcagcactgaaattgccaagaaagcagcagtaaaggggaagtgtataacgtgggggaaggtggtat
ctctgtacgcagtggctggaggtctggcggtggactgcgtgcgtcatggacacccagccatggtcgataccattgtggac
tgcctgggcgagtttgtgcgcaagagcctggtcgaatggctgaggagaaggggtggatgggctgacgtcacaaagtgtgt
agtgaacactgacccccgtctccggtctcactggctaatctctgctgcctgtacctgtggtcacttcgtcaaaaccgtgg
tcttctaccttctgcgagagcgctga
>gnl|bcl2dbcds|W5MHB6_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Lepisosteus oculatus GN=BOK (length=624 residues).
atggaggtgctgcgcaggtcttcggtgtttgctgctgaagtaatggaggtgtttgaccgctcccccacggacaaggagct
ggtctcccaggccaaggcgctctgcagggaatacatccactcccggctgaaccgagcgggactaggctggtccaaaccag
agcatgcggcccacggggaggtgtcctccgtcctgctgtggctcggcgatgagctggaatacctgcgacccaacatttac
cggaatgtggcgagacaactcagcatcactgtggcctcggagaacattgtgtcagatgccttcctggccgtagctgcaga
gatcttcagcactggtataacgtgggggaaggtggtatctctgtacgcagtggctggaggtctggcggtggactgcgtgc
gtcatggacacccagccatggtcgataccattgtggactgcctgggcgagtttgtgcgcaagagcctggtcgaatggctg
aggagaaggggtggatgggctgacgtcacaaagtgtgtagtgaacactgacccccgtctccggtctcactggctaatctc
tgctgcctgtacctgtggtcacttcgtcaaaaccgtggtcttctaccttctgcgagagcgctga
>gnl|bcl2dbcds|W5N4J7_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Lepisosteus oculatus GN=BAK1 (length=651 residues).
atggccacagggggcggagaggacccctggaagccgagtcagaatgaagacagccgtgagagcccgtccccagaaacagt
ctcagaggagaatgtggtgcaggagacagaggaggtcttctgcagctacgtctactaccggtacaaccaggagcgggagc
aggatggagacaagctgcccagggaccctgagatcatggcactgcacctcaacagcaccagcaccatgtctcgagttggg
cagcagctggccatcattggcgatgacatcaacaggcgctatgacctcagctttactagcatgctgtcccatctggccct
cacgcccgagaatgcctacaactacttctgcaagattgccaagagcctgtttgactctggaataaactggggtcgtgtga
tcgccctgctgagcttcgggtaccgcatggcactgcacgtcttccagcagggcatgacgggcttcctgagccgcatcgcc
cgcttcatcagcgactttctgctgcggcaccagatcgctcagtggatcgcacagcaaggaggctgggtggctgcgctgga
gctggacaatgtctatgtgaagtacatgctggctctgctggcagtcatcctccttggtcagttcatcgtccgacgattct
tcagctcctga
© 1998-2018