Dataset for CDS BAX of Organism Lepisosteus oculatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5MCT6_BAX-01 BCL2-associated X gene OS=[Eukaryota] Lepisosteus oculatus GN=BAX (length=621 residues).
atggcagattctaccggaagcaaccagggtaacgagatagatgaaaacggagcagttggtggtgaagatactgttgatga
tgtaatcattgaacaaggagctgttgtttttcgaggatatgttgtagaggcagctcgtgtggataaccaagaatttgtca
ttgctccggaggatttaggagggagaccaaatgaaggacaggacagtcaagtgaaagacattgtaagaaatttaattgaa
atagctgatgagctgaatagaaatgctgaactggaaagtcttctcagcagggttgagtttgactcggcagagagtttgtt
tttcactgtggcaaggaagatttttgaagacggtattaactggggacgagtggtggctctttttcacttggcttacaaac
ttataatcaaggcaatcacaagagaccgcaatgagattattcaaacgatcattggctgggtattaaatttcattggagaa
cacgtttcacgctggatcagagagcatggaggatgggagggtgtccggaattattcccagaatctgaggtggcagaatgt
ggctatatttgctgctgcagttctcacaggtgtcttggcatactggaagatgtccagctga
© 1998-2018