Dataset for CDS BAK1 of Organism Lepisosteus oculatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5N4J7_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Lepisosteus oculatus GN=BAK1 (length=651 residues).
atggccacagggggcggagaggacccctggaagccgagtcagaatgaagacagccgtgagagcccgtccccagaaacagt
ctcagaggagaatgtggtgcaggagacagaggaggtcttctgcagctacgtctactaccggtacaaccaggagcgggagc
aggatggagacaagctgcccagggaccctgagatcatggcactgcacctcaacagcaccagcaccatgtctcgagttggg
cagcagctggccatcattggcgatgacatcaacaggcgctatgacctcagctttactagcatgctgtcccatctggccct
cacgcccgagaatgcctacaactacttctgcaagattgccaagagcctgtttgactctggaataaactggggtcgtgtga
tcgccctgctgagcttcgggtaccgcatggcactgcacgtcttccagcagggcatgacgggcttcctgagccgcatcgcc
cgcttcatcagcgactttctgctgcggcaccagatcgctcagtggatcgcacagcaaggaggctgggtggctgcgctgga
gctggacaatgtctatgtgaagtacatgctggctctgctggcagtcatcctccttggtcagttcatcgtccgacgattct
tcagctcctga
© 1998-2018