Dataset for CDS Unclassified of Organism Lepeophtheirus salmonis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|D3PFN5_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Lepeophtheirus salmonis (length=852 residues).
atggctcgaaaattcccccagtttcggtatagcaaggatggcgatgaagcagatgatgacgatgaagaagaaggagccat
tcctgtttcgccccggatcttgagacgtcgtcgcaactctgagcatgacatgagccatactccaaggaggatgtataatc
gtcctagatttaattccttctccaatgatggattttttccaattgaaaacattacagagtctcactccaatgacgaaggc
ttttcagaaaatgaaatcgagggccaggaactatatttacatttcctttatgagaggatgagtggagaaggcttggaccc
cgaggctcattccggtctctctgaataccactttaattccgttcacgatagagaaaggggccgtcaaaattccatgtcac
tagataatttccatagtcctctatggagaaggactggaagagagttacagagccttgcagatgaattcgtaagaacgcaa
gagcgagagcaagttcgaattctagcggactccgtggatgttgtgtctttaaatatggagaaattttttgcactcttaag
agaactctttcaaggaggaaaaatcactcgagaacggatacttgttttgttcttcttttgtagcgatatagcaatacgtg
cagcccgctgtcaaatggatggcctacttgttacattgacgaattggtctttacgattcatacgagaaaaggtatgctca
tgggtgaatctaaatggaggttggcaaacggttttacaccggggggtcaatgttgttcagcagatggccattatcggaat
gtgtgccgcagtcatgttatgttgcactatatatattagaaaaaatctttga
© 1998-2018