Dataset for CDS Unclassified of Organism Latimeria chalumnae

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H3A443_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Latimeria chalumnae (length=576 residues).
atggcgttagcacaccatgaagaccctgtagtaaaagaggcttatttaatgttgcatgattacattgcttatgtgacagg
tagaaaaaccagtccagctccttctaaagcggctgcagctttgagatatgctggggatgaccttttggagaaattcccaa
ttttcttcaagcgatggccccgtctttttagtggtgtgtcagaagataaagccagtgatctcctgctgaaaattttggat
gaccacttcaagccacaacaagcagggcggccaaaggaaataacatggagtgggattctctctatttacattgtagctgg
acagatggccatttattgccaggagaatggcatggagggggtacttgagagtttggcaatgcaggttggacaatatgtgg
agaaaacagtgtgtccttttatcagggaaaagggtggctgggttggctttacgacacgctatgcgaagaaagaagatgct
gaaaccaaagtactgaaagtgtgctgtggaaccttgcttaccctggcaatgctcagtcttctttactacacatggaacaa
gagattgacgagatga
© 1998-2018