Dataset for CDS BOK of Organism Latimeria chalumnae

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H3AJU3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Latimeria chalumnae GN=BOK (length=333 residues).
atggagatgctccgacgctcctcggtctttgctgccgaagtgatggaggtttttgaccgagcccccaccgataaggagct
ggtgtcccagtccaaggttctgtgccgggcctatatccattcccggctgatccgggctaggatcggctgggtgaagcccg
aatacagcatgccagcccccggaggcaaactggccgaggtgtccgccgtcctgctccgactgggagatgagctggaatac
attcgtccaaacgtctacaggaacattgccaaacagcttaacatcttgctgaattcggaaaccattgtgtcggatgcttt
tcttgctgttgct
© 1998-2018