Dataset for CDS BAX-like of Organism Latimeria chalumnae

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|H3ABM8_BAX-01 BCL2-associated X gene OS=[Eukaryota] Latimeria chalumnae GN=BAX (length=672 residues).
atggcggatgagtgcggttgtgaggatagtcttggcagcgcggaggctgcctgggccgcgggagacagcagtccccgggc
tcagatggggagaaggacgcctgctagcaacgcagataatgctacggagcagatcttacagacaggacaggtgttattaa
aagggttcatcttggaccgaatccagcgtggtgtcgaaacacggtgcgtgcaagtgactccagaccagctgggagtgacg
gaggagcagctgagcaatcccagcttcaagaacttggcgaactgtctgagacaaattggggatgagctggatgggaacca
ggtgctccaaagagagatcagccgagtgaagactgactcctcgaaagaagtcttctttcaggtggtgagagaggtgttct
ctgatgggaagttcaactggggccgcgtggtggcactcttctacttcgcctgcaagctgatcatcagggctttatgcgaa
aacattcccaagatagtgcggaccatcattgagtggaccatggaatacctgcgggatcatgttgtccagtggatccggga
acaaggaggatgggacagcatctgcttgtacgtgaagagacacaattaccatgtgacaatgatttttctcaccggctttt
tggctgcttttcttgtcatgcggttctcctag
>gnl|bcl2dbcds|H3AJU3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Latimeria chalumnae GN=BOK (length=333 residues).
atggagatgctccgacgctcctcggtctttgctgccgaagtgatggaggtttttgaccgagcccccaccgataaggagct
ggtgtcccagtccaaggttctgtgccgggcctatatccattcccggctgatccgggctaggatcggctgggtgaagcccg
aatacagcatgccagcccccggaggcaaactggccgaggtgtccgccgtcctgctccgactgggagatgagctggaatac
attcgtccaaacgtctacaggaacattgccaaacagcttaacatcttgctgaattcggaaaccattgtgtcggatgcttt
tcttgctgttgct
>gnl|bcl2dbcds|H3ASQ4_BAX-01 BCL2-associated X gene OS=[Eukaryota] Latimeria chalumnae GN=BAX (length=627 residues).
atggcaactcccgttaaaacggaggggtccggaaaagagaagaaagaaaaccaaggtggtgctggaggcactggagacgc
agcagatgagcagctaaagcagcaagcaggaaacgtcttacgtggatttatagtacagttgactcataatgatgaccaag
aaatccatctcaggccagaggaccttggtggctctcagaacgatatagaaaacccaaagacaaaggagattgttaacaat
ttaattaaaattggagatgagcttaataagaatgttgaattgcagaggatgattgaaaatgttcccattgggtctgctca
ggaagtgttttttcaagtagcacaaagcctatttgctgggggcattaactggggaaggatcgttgcccttttctacttta
cctccaaacttgtacttaaggcaataacaaccaaccttagagaaataataacaaccatagtcaactggacattggatttc
attgtacaaaatgtaatacggtgggttcgtgaacaaggaggatgggaaaatgttcgcaataacttctactctatgaactg
gcagaatgtggcgttctttgcagcgggagtccttaccggagttttggctttctggaaactgacttaa
>gnl|bcl2dbcds|H3B8S5_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Latimeria chalumnae GN=BAK1 (length=720 residues).
atgaaatggtactgggactggcgtttgaatgagggtgaagccacttctccagagcacagcgttatgtcctcggaaggtgg
cagtggtgatggcaacggtgagaagttgggccgcactccagagaaagatgaaccactttccaggcacaacacagtgcaag
atgtggtgcgagagacggaggaggtgtttctgggatatgtacagtatcgataccagcaggagagagaacagaatatcgtg
caggttcctgatgactatgagatcaatcagatcgaacaggagcccaacagtatgacggcccaagtgggacagcggttggc
aattatcggtgatgatattaacaagcggtatgatcgagagttcactgcaatgctgagcgcattaccactcaccatggaga
atgcttatagttacttccagaaaatagctgagggtttatttgactctggtattaactggggccgggtgatcgccctgtta
ggatttggttaccggatggcgctccatgtctaccgacagggcttcacagggttcctcaccagcattgcccagtttgtgtc
tcgattccttctgcagaacaggattgcacagtggattgctcagcaaggtggatgggtggcagcattggatcttgacaacg
tttacatgaagtacttgctggctatcttgggagtggttctgattgggcactttgtgctgcgccgtttcttcaaccattga
© 1998-2018