Dataset for CDS BAK1 of Organism Latimeria chalumnae

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H3B8S5_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Latimeria chalumnae GN=BAK1 (length=720 residues).
atgaaatggtactgggactggcgtttgaatgagggtgaagccacttctccagagcacagcgttatgtcctcggaaggtgg
cagtggtgatggcaacggtgagaagttgggccgcactccagagaaagatgaaccactttccaggcacaacacagtgcaag
atgtggtgcgagagacggaggaggtgtttctgggatatgtacagtatcgataccagcaggagagagaacagaatatcgtg
caggttcctgatgactatgagatcaatcagatcgaacaggagcccaacagtatgacggcccaagtgggacagcggttggc
aattatcggtgatgatattaacaagcggtatgatcgagagttcactgcaatgctgagcgcattaccactcaccatggaga
atgcttatagttacttccagaaaatagctgagggtttatttgactctggtattaactggggccgggtgatcgccctgtta
ggatttggttaccggatggcgctccatgtctaccgacagggcttcacagggttcctcaccagcattgcccagtttgtgtc
tcgattccttctgcagaacaggattgcacagtggattgctcagcaaggtggatgggtggcagcattggatcttgacaacg
tttacatgaagtacttgctggctatcttgggagtggttctgattgggcactttgtgctgcgccgtttcttcaaccattga
© 1998-2018